EMAIL THIS PAGE TO A FRIEND

TPD52L1

tumor protein D52-like 1

Synonyms: D53 hD53
Gene ID:
Human(7164) Summary: This gene encodes a member of the tumor protein D52 (TPD52) family. The encoded protein contains a coiled-coil domain and may form homo- or hetero-dimer with TPD52 family members. The protein is reported to be involved in cell proliferation and calcium signaling. It also interacts with the mitogen-activated protein kinase kinase kinase 5 (MAP3K5/ASK1) and positively regulates MAP3K5-induced apoptosis. Multiple alternatively spliced transcript variants have been observed, but the full-length nature of some variants has not yet been determined. [provided by RefSeq, Jul 2008]
Mouse(21987) tumor protein D52-like 1
Rat(689256) tumor protein D52-like 1
cow(534629) tumor protein D52-like 1
sheep(101118879) tumor protein D52-like 1
naked mole-rat(101716681) tumor protein D52-like 1
domestic guinea pig(100727276) tumor protein D52-like 1
Zebrafish(553769) tumor protein D52-like 1
domestic cat(101090108) tumor protein D52-like 1
dog(612660) tumor protein D52-like 1
chicken(374049) tumor protein D52-like 1
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083901 MISSION® esiRNA esiRNA human TPD52L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003395 Rosetta Predictions human pricing
NM_001003396 Rosetta Predictions human pricing
NM_001003397 Rosetta Predictions human pricing
NM_003287 Rosetta Predictions human pricing
NM_001044295 Rosetta Predictions rat pricing
NM_009413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033368 predicted 1106
2 SASI_Hs01_00033369 predicted 1031
3 SASI_Hs01_00033370 predicted 1036
4 SASI_Hs01_00033371 predicted 1159
5 SASI_Hs01_00033372 predicted 1120
6 SASI_Hs01_00033373 predicted 1106
7 SASI_Hs01_00033374 predicted 1121
8 SASI_Hs01_00033375 predicted 989
9 SASI_Hs01_00033376 predicted 1090
10 SASI_Hs01_00033377 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163766 predicted 1021
2 SASI_Hs01_00163767 predicted 948
3 SASI_Hs01_00163768 predicted 954
4 SASI_Hs01_00163769 predicted 1069
5 SASI_Hs01_00163770 predicted 1032
6 SASI_Hs01_00163771 predicted 1027
7 SASI_Hs01_00163772 predicted 1034
8 SASI_Hs01_00163773 predicted 907
9 SASI_Hs01_00163774 predicted 1016
10 SASI_Hs01_00163775 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123479 predicted 982
2 SASI_Hs01_00123480 predicted 913
3 SASI_Hs01_00123481 predicted 918
4 SASI_Hs01_00123482 predicted 1030
5 SASI_Hs01_00123483 predicted 1001
6 SASI_Hs01_00123484 predicted 985
7 SASI_Hs01_00123485 predicted 1000
8 SASI_Hs01_00123486 predicted 866
9 SASI_Hs01_00123487 predicted 973
10 SASI_Hs01_00123488 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109898 predicted 1091
2 SASI_Hs01_00109899 predicted 1005
3 SASI_Hs01_00109900 predicted 1014
4 SASI_Hs01_00109901 predicted 1129
5 SASI_Hs01_00109902 predicted 1102
6 SASI_Hs01_00109903 predicted 1085
7 SASI_Hs01_00109904 predicted 1099
8 SASI_Hs01_00109905 predicted 968
9 SASI_Hs01_00109906 predicted 1071
10 SASI_Hs01_00109907 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205624 predicted 215
2 SASI_Rn02_00205625 predicted 991
3 SASI_Rn02_00205626 predicted 212
4 SASI_Rn02_00205627 predicted 368
5 SASI_Rn02_00205628 predicted 940
6 SASI_Rn02_00205629 predicted 517
7 SASI_Rn02_00205630 predicted 573
8 SASI_Rn02_00205631 predicted 854
9 SASI_Rn02_00205632 predicted 952
10 SASI_Rn02_00205633 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176048 predicted 400
2 SASI_Mm01_00176049 predicted 320
3 SASI_Mm01_00176050 predicted 960
4 SASI_Mm02_00316063 predicted 1010
5 SASI_Mm01_00176051 predicted 961
6 SASI_Mm01_00176052 predicted 676
7 SASI_Mm01_00176053 predicted 297
8 SASI_Mm01_00176054 predicted 967
9 SASI_Mm01_00176055 predicted 658
10 SASI_Mm01_00176056 predicted 553
11 SASI_Mm01_00176057 predicted 940
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003287
VALIDATED
TPD52L1 MISSION shRNA Bacterial Glycerol Stock
tumor protein D52-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003287.2-340s21c1
Sequence:CCGGGCAGAGTTAGTTCAGCTAGAACTCGAGTTCTAGCTGAACTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003287.2-1080s21c1
Sequence:CCGGAGGTACACAACTGGTCATAATCTCGAGATTATGACCAGTTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003287.2-713s21c1
Sequence:CCGGTAGGCGGTACGAACCCTAATGCTCGAGCATTAGGGTTCGTACCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003287.2-434s21c1
Sequence:CCGGGCATGAACCTGATGAATGAATCTCGAGATTCATTCATCAGGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003287.1-391s1c1
Sequence:CCGGCTCGGCATGAACCTGATGAATCTCGAGATTCATCAGGTTCATGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-561s1c1
Sequence:CCGGCATGAGTTACTCCATTCGCCACTCGAGTGGCGAATGGAGTAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-395s1c1
Sequence:CCGGGCATGAACCTGATGAATGAATCTCGAGATTCATTCATCAGGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-301s1c1
Sequence:CCGGGCAGAGTTAGTTCAGCTAGAACTCGAGTTCTAGCTGAACTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003287.1-555s1c1
Sequence:CCGGCGGAGACATGAGTTACTCCATCTCGAGATGGAGTAACTCATGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003287.1-258s1c1
Sequence:CCGGCTTCTCTAGCATGCTCTCTGACTCGAGTCAGAGAGCATGCTAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003287
VALIDATED
TPD52L1 MISSION shRNA shRNA Plasmid DNA
tumor protein D52-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003287.2-340s21c1
Sequence:CCGGGCAGAGTTAGTTCAGCTAGAACTCGAGTTCTAGCTGAACTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003287.2-1080s21c1
Sequence:CCGGAGGTACACAACTGGTCATAATCTCGAGATTATGACCAGTTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003287.2-713s21c1
Sequence:CCGGTAGGCGGTACGAACCCTAATGCTCGAGCATTAGGGTTCGTACCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003287.2-434s21c1
Sequence:CCGGGCATGAACCTGATGAATGAATCTCGAGATTCATTCATCAGGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003287.1-391s1c1
Sequence:CCGGCTCGGCATGAACCTGATGAATCTCGAGATTCATCAGGTTCATGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-561s1c1
Sequence:CCGGCATGAGTTACTCCATTCGCCACTCGAGTGGCGAATGGAGTAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-395s1c1
Sequence:CCGGGCATGAACCTGATGAATGAATCTCGAGATTCATTCATCAGGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-301s1c1
Sequence:CCGGGCAGAGTTAGTTCAGCTAGAACTCGAGTTCTAGCTGAACTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003287.1-555s1c1
Sequence:CCGGCGGAGACATGAGTTACTCCATCTCGAGATGGAGTAACTCATGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003287.1-258s1c1
Sequence:CCGGCTTCTCTAGCATGCTCTCTGACTCGAGTCAGAGAGCATGCTAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003287
VALIDATED
TPD52L1 MISSION shRNA Lentiviral Transduction Particles
tumor protein D52-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003287.2-340s21c1
Sequence:CCGGGCAGAGTTAGTTCAGCTAGAACTCGAGTTCTAGCTGAACTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003287.2-1080s21c1
Sequence:CCGGAGGTACACAACTGGTCATAATCTCGAGATTATGACCAGTTGTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003287.2-713s21c1
Sequence:CCGGTAGGCGGTACGAACCCTAATGCTCGAGCATTAGGGTTCGTACCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003287.2-434s21c1
Sequence:CCGGGCATGAACCTGATGAATGAATCTCGAGATTCATTCATCAGGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003287.1-391s1c1
Sequence:CCGGCTCGGCATGAACCTGATGAATCTCGAGATTCATCAGGTTCATGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-561s1c1
Sequence:CCGGCATGAGTTACTCCATTCGCCACTCGAGTGGCGAATGGAGTAACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-395s1c1
Sequence:CCGGGCATGAACCTGATGAATGAATCTCGAGATTCATTCATCAGGTTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003287.1-301s1c1
Sequence:CCGGGCAGAGTTAGTTCAGCTAGAACTCGAGTTCTAGCTGAACTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003287.1-555s1c1
Sequence:CCGGCGGAGACATGAGTTACTCCATCTCGAGATGGAGTAACTCATGTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003287.1-258s1c1
Sequence:CCGGCTTCTCTAGCATGCTCTCTGACTCGAGTCAGAGAGCATGCTAGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009413
VALIDATED
TPD52L1 MISSION shRNA Bacterial Glycerol Stock
tumor protein D52-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-1062s1c1
Sequence:CCGGCCAATCATGCAGATACTGATTCTCGAGAATCAGTATCTGCATGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009413.1-666s1c1
Sequence:CCGGGCAAGCCTCAAGACGAAAGTACTCGAGTACTTTCGTCTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-401s1c1
Sequence:CCGGACTCGGCATGAATCTGATGAACTCGAGTTCATCAGATTCATGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-330s1c1
Sequence:CCGGGAAGACGAAATCACAACATTACTCGAGTAATGTTGTGATTTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-402s1c1
Sequence:CCGGCTCGGCATGAATCTGATGAATCTCGAGATTCATCAGATTCATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009413
VALIDATED
TPD52L1 MISSION shRNA shRNA Plasmid DNA
tumor protein D52-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-1062s1c1
Sequence:CCGGCCAATCATGCAGATACTGATTCTCGAGAATCAGTATCTGCATGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009413.1-666s1c1
Sequence:CCGGGCAAGCCTCAAGACGAAAGTACTCGAGTACTTTCGTCTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-401s1c1
Sequence:CCGGACTCGGCATGAATCTGATGAACTCGAGTTCATCAGATTCATGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-330s1c1
Sequence:CCGGGAAGACGAAATCACAACATTACTCGAGTAATGTTGTGATTTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-402s1c1
Sequence:CCGGCTCGGCATGAATCTGATGAATCTCGAGATTCATCAGATTCATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009413
VALIDATED
TPD52L1 MISSION shRNA Lentiviral Transduction Particles
tumor protein D52-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-1062s1c1
Sequence:CCGGCCAATCATGCAGATACTGATTCTCGAGAATCAGTATCTGCATGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009413.1-666s1c1
Sequence:CCGGGCAAGCCTCAAGACGAAAGTACTCGAGTACTTTCGTCTTGAGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-401s1c1
Sequence:CCGGACTCGGCATGAATCTGATGAACTCGAGTTCATCAGATTCATGCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-330s1c1
Sequence:CCGGGAAGACGAAATCACAACATTACTCGAGTAATGTTGTGATTTCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009413.1-402s1c1
Sequence:CCGGCTCGGCATGAATCTGATGAATCTCGAGATTCATCAGATTCATGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks