EMAIL THIS PAGE TO A FRIEND

TPD52L2

tumor protein D52-like 2

Synonyms: D54
Gene ID:
Human(7165) Summary: This gene encodes a member of the tumor protein D52-like family. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. Expression of this gene may be a marker for breast cancer and acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 12. [provided by RefSeq, Aug 2011]
Mouse(66314) tumor protein D52-like 2
Rat(296480) tumor protein D52-like 2
chicken(419257) tumor protein D52-like 2
Horse(100060965) tumor protein D52-like 2
domestic cat(101092259) tumor protein D52-like 2
dog(610715) tumor protein D52-like 2
domestic guinea pig(100728763) tumor protein D52-like 2
naked mole-rat(101697938) tumor protein D52-like 2
cow(534704) tumor protein D52-like 2
sheep(101116591) tumor protein D52-like 2
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003288 Rosetta Predictions human pricing
NM_199359 Rosetta Predictions human pricing
NM_199360 Rosetta Predictions human pricing
NM_199361 Rosetta Predictions human pricing
NM_199362 Rosetta Predictions human pricing
NM_199363 Rosetta Predictions human pricing
NM_198744 Rosetta Predictions rat pricing
NM_025482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212953 predicted 1061
2 SASI_Hs01_00212955 predicted 1177
3 SASI_Hs01_00212956 predicted 941
4 SASI_Hs01_00212957 predicted 1084
5 SASI_Hs01_00212958 predicted 894
6 SASI_Hs01_00212959 predicted 1058
7 SASI_Hs02_00335356 predicted 1172
8 SASI_Hs01_00212960 predicted 1065
9 SASI_Hs01_00212961 predicted 1086
10 SASI_Hs01_00212962 predicted 1088
11 SASI_Hs01_00212954 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247494 predicted 996
2 SASI_Hs01_00247496 predicted 1120
3 SASI_Hs01_00247497 predicted 882
4 SASI_Hs01_00247498 predicted 1025
5 SASI_Hs01_00247499 predicted 836
6 SASI_Hs01_00247500 predicted 1004
7 SASI_Hs02_00372800 predicted 1113
8 SASI_Hs01_00247501 predicted 1008
9 SASI_Hs01_00247502 predicted 1018
10 SASI_Hs01_00247503 predicted 1031
11 SASI_Hs01_00247495 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092807 predicted 1129
2 SASI_Hs01_00092809 predicted 1254
3 SASI_Hs01_00092810 predicted 1017
4 SASI_Hs01_00092811 predicted 1155
5 SASI_Hs01_00092812 predicted 964
6 SASI_Hs01_00092813 predicted 1133
7 SASI_Hs02_00372801 predicted 1242
8 SASI_Hs01_00092814 predicted 1140
9 SASI_Hs01_00092815 predicted 1148
10 SASI_Hs01_00092816 predicted 1155
11 SASI_Hs01_00092808 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115949 predicted 1069
2 SASI_Hs01_00115951 predicted 1187
3 SASI_Hs01_00115952 predicted 954
4 SASI_Hs01_00115953 predicted 1091
5 SASI_Hs01_00115954 predicted 908
6 SASI_Hs01_00115955 predicted 1067
7 SASI_Hs02_00372802 predicted 1179
8 SASI_Hs01_00115956 predicted 1073
9 SASI_Hs01_00115957 predicted 1094
10 SASI_Hs01_00115958 predicted 1094
11 SASI_Hs01_00115950 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119835 predicted 1097
2 SASI_Hs01_00119837 predicted 1223
3 SASI_Hs01_00119838 predicted 987
4 SASI_Hs01_00119839 predicted 1124
5 SASI_Hs01_00119840 predicted 937
6 SASI_Hs01_00119841 predicted 1104
7 SASI_Hs02_00372803 predicted 1217
8 SASI_Hs01_00119842 predicted 1111
9 SASI_Hs01_00119843 predicted 1125
10 SASI_Hs01_00119844 predicted 1136
11 SASI_Hs01_00119836 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182382 predicted 1037
2 SASI_Hs01_00182384 predicted 1164
3 SASI_Hs01_00182385 predicted 927
4 SASI_Hs01_00182386 predicted 1070
5 SASI_Hs01_00182387 predicted 875
6 SASI_Hs01_00182388 predicted 1048
7 SASI_Hs02_00372804 predicted 1154
8 SASI_Hs01_00182389 predicted 1047
9 SASI_Hs01_00182390 predicted 1060
10 SASI_Hs01_00182391 predicted 1071
11 SASI_Hs01_00182383 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269968 predicted 1137
2 SASI_Rn01_00042302 predicted 1140
3 SASI_Rn01_00042303 predicted 547
4 SASI_Rn01_00042304 predicted 1001
5 SASI_Rn01_00042306 predicted 969
6 SASI_Rn01_00042307 predicted 649
7 SASI_Rn01_00042308 predicted 711
8 SASI_Rn01_00042309 predicted 619
9 SASI_Rn01_00042310 predicted 680
10 SASI_Rn01_00042311 predicted 920
11 SASI_Rn01_00042305 predicted 981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175209 predicted 697
2 SASI_Mm01_00175210 predicted 1045
3 SASI_Mm01_00175211 predicted 522
4 SASI_Mm01_00175212 predicted 641
5 SASI_Mm01_00175213 predicted 910
6 SASI_Mm01_00175214 predicted 540
7 SASI_Mm01_00175215 predicted 877
8 SASI_Mm01_00175216 predicted 876
9 SASI_Mm01_00175218 predicted 615
10 SASI_Mm02_00328353 predicted 206
11 SASI_Mm01_00175217 predicted 951
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025482
VALIDATED
TPD52L2 MISSION shRNA Bacterial Glycerol Stock
tumor protein D52-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025482.2-587s1c1
Sequence:CCGGGCCACCTTCAAGTCATTTGAACTCGAGTTCAAATGACTTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025482.2-431s1c1
Sequence:CCGGGACCTCTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025482.2-645s1c1
Sequence:CCGGGCAGAGAGAATGGCAGCGATACTCGAGTATCGCTGCCATTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025482.2-556s1c1
Sequence:CCGGCTCGATAAGTATGCCTGTCATCTCGAGATGACAGGCATACTTATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025482.2-2151s1c1
Sequence:CCGGGCTGAAGAAGAGCACACCATTCTCGAGAATGGTGTGCTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025482.2-864s21c1
Sequence:CCGGGGCTGCCTTGGCATGAATTAGCTCGAGCTAATTCATGCCAAGGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-587s21c1
Sequence:CCGGGCCACCTTCAAGTCATTTGAACTCGAGTTCAAATGACTTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025482.2-1119s21c1
Sequence:CCGGATACACTTACCTAGGTAATATCTCGAGATATTACCTAGGTAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-431s21c1
Sequence:CCGGGACCTCTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-106s21c1
Sequence:CCGGAGGTGTGCTGTCTGACTTTATCTCGAGATAAAGTCAGACAGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025482
VALIDATED
TPD52L2 MISSION shRNA shRNA Plasmid DNA
tumor protein D52-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025482.2-587s1c1
Sequence:CCGGGCCACCTTCAAGTCATTTGAACTCGAGTTCAAATGACTTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025482.2-431s1c1
Sequence:CCGGGACCTCTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025482.2-645s1c1
Sequence:CCGGGCAGAGAGAATGGCAGCGATACTCGAGTATCGCTGCCATTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025482.2-556s1c1
Sequence:CCGGCTCGATAAGTATGCCTGTCATCTCGAGATGACAGGCATACTTATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025482.2-2151s1c1
Sequence:CCGGGCTGAAGAAGAGCACACCATTCTCGAGAATGGTGTGCTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025482.2-864s21c1
Sequence:CCGGGGCTGCCTTGGCATGAATTAGCTCGAGCTAATTCATGCCAAGGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-587s21c1
Sequence:CCGGGCCACCTTCAAGTCATTTGAACTCGAGTTCAAATGACTTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025482.2-1119s21c1
Sequence:CCGGATACACTTACCTAGGTAATATCTCGAGATATTACCTAGGTAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-431s21c1
Sequence:CCGGGACCTCTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-106s21c1
Sequence:CCGGAGGTGTGCTGTCTGACTTTATCTCGAGATAAAGTCAGACAGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025482
VALIDATED
TPD52L2 MISSION shRNA Lentiviral Transduction Particles
tumor protein D52-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025482.2-587s1c1
Sequence:CCGGGCCACCTTCAAGTCATTTGAACTCGAGTTCAAATGACTTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025482.2-431s1c1
Sequence:CCGGGACCTCTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025482.2-645s1c1
Sequence:CCGGGCAGAGAGAATGGCAGCGATACTCGAGTATCGCTGCCATTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025482.2-556s1c1
Sequence:CCGGCTCGATAAGTATGCCTGTCATCTCGAGATGACAGGCATACTTATCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025482.2-2151s1c1
Sequence:CCGGGCTGAAGAAGAGCACACCATTCTCGAGAATGGTGTGCTCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025482.2-864s21c1
Sequence:CCGGGGCTGCCTTGGCATGAATTAGCTCGAGCTAATTCATGCCAAGGCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-587s21c1
Sequence:CCGGGCCACCTTCAAGTCATTTGAACTCGAGTTCAAATGACTTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025482.2-1119s21c1
Sequence:CCGGATACACTTACCTAGGTAATATCTCGAGATATTACCTAGGTAAGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-431s21c1
Sequence:CCGGGACCTCTACAAGAAGACTCAACTCGAGTTGAGTCTTCTTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025482.2-106s21c1
Sequence:CCGGAGGTGTGCTGTCTGACTTTATCTCGAGATAAAGTCAGACAGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003288
VALIDATED
TPD52L2 MISSION shRNA Bacterial Glycerol Stock
tumor protein D52-like 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-1692s1c1
Sequence:CCGGCCCTGTCTTTAGCACCCTTTACTCGAGTAAAGGGTGCTAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-286s1c1
Sequence:CCGGCTTACCAAGGTGGAAGAGGAACTCGAGTTCCTCTTCCACCTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-592s1c1
Sequence:CCGGCTTGGAGACATGAGGAACTCTCTCGAGAGAGTTCCTCATGTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-474s1c1
Sequence:CCGGGTGGAATGAGAAAGTGACCCACTCGAGTGGGTCACTTTCTCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003288.2-645s1c1
Sequence:CCGGGACCATAAAGTCTAAGGTTGTCTCGAGACAACCTTAGACTTTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-502s1c1
Sequence:CCGGCTCTACAAGAAGACTCAGGAACTCGAGTTCCTGAGTCTTCTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-1014s1c1
Sequence:CCGGGCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-466s1c1
Sequence:CCGGCTTGGAGAGTGGAATGAGAAACTCGAGTTTCTCATTCCACTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-517s1c1
Sequence:CCGGCAGGAAACTCTTTCACAGGCACTCGAGTGCCTGTGAAAGAGTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-645s21c1
Sequence:CCGGGACCATAAAGTCTAAGGTTGTCTCGAGACAACCTTAGACTTTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-517s21c1
Sequence:CCGGCAGGAAACTCTTTCACAGGCACTCGAGTGCCTGTGAAAGAGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-1014s21c1
Sequence:CCGGGCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-1692s21c1
Sequence:CCGGCCCTGTCTTTAGCACCCTTTACTCGAGTAAAGGGTGCTAAAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-592s21c1
Sequence:CCGGCTTGGAGACATGAGGAACTCTCTCGAGAGAGTTCCTCATGTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003288
VALIDATED
TPD52L2 MISSION shRNA shRNA Plasmid DNA
tumor protein D52-like 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-1692s1c1
Sequence:CCGGCCCTGTCTTTAGCACCCTTTACTCGAGTAAAGGGTGCTAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-286s1c1
Sequence:CCGGCTTACCAAGGTGGAAGAGGAACTCGAGTTCCTCTTCCACCTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-592s1c1
Sequence:CCGGCTTGGAGACATGAGGAACTCTCTCGAGAGAGTTCCTCATGTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-474s1c1
Sequence:CCGGGTGGAATGAGAAAGTGACCCACTCGAGTGGGTCACTTTCTCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003288.2-645s1c1
Sequence:CCGGGACCATAAAGTCTAAGGTTGTCTCGAGACAACCTTAGACTTTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-502s1c1
Sequence:CCGGCTCTACAAGAAGACTCAGGAACTCGAGTTCCTGAGTCTTCTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-1014s1c1
Sequence:CCGGGCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-466s1c1
Sequence:CCGGCTTGGAGAGTGGAATGAGAAACTCGAGTTTCTCATTCCACTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-517s1c1
Sequence:CCGGCAGGAAACTCTTTCACAGGCACTCGAGTGCCTGTGAAAGAGTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-645s21c1
Sequence:CCGGGACCATAAAGTCTAAGGTTGTCTCGAGACAACCTTAGACTTTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-517s21c1
Sequence:CCGGCAGGAAACTCTTTCACAGGCACTCGAGTGCCTGTGAAAGAGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-1014s21c1
Sequence:CCGGGCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-1692s21c1
Sequence:CCGGCCCTGTCTTTAGCACCCTTTACTCGAGTAAAGGGTGCTAAAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-592s21c1
Sequence:CCGGCTTGGAGACATGAGGAACTCTCTCGAGAGAGTTCCTCATGTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003288
VALIDATED
TPD52L2 MISSION shRNA Lentiviral Transduction Particles
tumor protein D52-like 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-1692s1c1
Sequence:CCGGCCCTGTCTTTAGCACCCTTTACTCGAGTAAAGGGTGCTAAAGACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-286s1c1
Sequence:CCGGCTTACCAAGGTGGAAGAGGAACTCGAGTTCCTCTTCCACCTTGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-592s1c1
Sequence:CCGGCTTGGAGACATGAGGAACTCTCTCGAGAGAGTTCCTCATGTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-474s1c1
Sequence:CCGGGTGGAATGAGAAAGTGACCCACTCGAGTGGGTCACTTTCTCATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003288.2-645s1c1
Sequence:CCGGGACCATAAAGTCTAAGGTTGTCTCGAGACAACCTTAGACTTTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-502s1c1
Sequence:CCGGCTCTACAAGAAGACTCAGGAACTCGAGTTCCTGAGTCTTCTTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-1014s1c1
Sequence:CCGGGCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-466s1c1
Sequence:CCGGCTTGGAGAGTGGAATGAGAAACTCGAGTTTCTCATTCCACTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003288.2-517s1c1
Sequence:CCGGCAGGAAACTCTTTCACAGGCACTCGAGTGCCTGTGAAAGAGTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-645s21c1
Sequence:CCGGGACCATAAAGTCTAAGGTTGTCTCGAGACAACCTTAGACTTTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-517s21c1
Sequence:CCGGCAGGAAACTCTTTCACAGGCACTCGAGTGCCTGTGAAAGAGTTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-1014s21c1
Sequence:CCGGGCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-1692s21c1
Sequence:CCGGCCCTGTCTTTAGCACCCTTTACTCGAGTAAAGGGTGCTAAAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003288.2-592s21c1
Sequence:CCGGCTTGGAGACATGAGGAACTCTCTCGAGAGAGTTCCTCATGTCTCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks