EMAIL THIS PAGE TO A FRIEND

TPD52L3

tumor protein D52-like 3

Synonyms: NYDSP25 hD55
Gene ID:
Human(89882) Summary: This gene encodes a member of the tumor protein D52-like family of proteins. These proteins are characterized by an N-terminal coiled-coil motif that is used to form homo- and heteromeric complexes with other tumor protein D52-like proteins. The encoded protein may play a role in spermatogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Rat(293894) tumor protein D52-like 3
dog(481533) tumor protein D52-like 3
cow(767900) tumor protein D52-like 3
sheep(101116963) tumor protein D52-like 3
215 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033516 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141571 MISSION® esiRNA esiRNA human TPD52L3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001874 Rosetta Predictions human pricing
NM_001001875 Rosetta Predictions human pricing
NM_033516 Rosetta Predictions human pricing
NM_001106349 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055412 predicted 236
2 SASI_Hs01_00055413 predicted 357
3 SASI_Hs01_00055414 predicted 352
4 SASI_Hs01_00055415 predicted 297
5 SASI_Hs01_00055416 predicted 266
6 SASI_Hs01_00055417 predicted 336
7 SASI_Hs01_00055418 predicted 243
8 SASI_Hs01_00055419 predicted 290
9 SASI_Hs01_00055421 predicted 265
10 SASI_Hs02_00303965 predicted 265
11 SASI_Hs01_00055420 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204798 predicted 241
2 SASI_Hs01_00204799 predicted 357
3 SASI_Hs01_00204800 predicted 359
4 SASI_Hs01_00204801 predicted 296
5 SASI_Hs01_00204802 predicted 265
6 SASI_Hs01_00204803 predicted 339
7 SASI_Hs01_00204804 predicted 240
8 SASI_Hs01_00204805 predicted 285
9 SASI_Hs01_00204807 predicted 260
10 SASI_Hs02_00303966 predicted 270
11 SASI_Hs01_00204806 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052008 predicted 236
2 SASI_Hs01_00052009 predicted 353
3 SASI_Hs01_00052010 predicted 353
4 SASI_Hs01_00052011 predicted 291
5 SASI_Hs01_00052012 predicted 269
6 SASI_Hs01_00052013 predicted 336
7 SASI_Hs01_00052014 predicted 237
8 SASI_Hs01_00052015 predicted 287
9 SASI_Hs01_00052017 predicted 266
10 SASI_Hs02_00361403 predicted 268
11 SASI_Hs01_00052016 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218098 predicted 330
2 SASI_Rn02_00218099 predicted 1068
3 SASI_Rn02_00218100 predicted 1012
4 SASI_Rn02_00218101 predicted 764
5 SASI_Rn02_00218102 predicted 216
6 SASI_Rn02_00218103 predicted 997
7 SASI_Rn02_00218104 predicted 930
8 SASI_Rn02_00218105 predicted 451
9 SASI_Rn02_00218106 predicted 588
10 SASI_Rn02_00218107 predicted 1004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033516
VALIDATED
TPD52L3 MISSION shRNA Bacterial Glycerol Stock
tumor protein D52-like 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033516.4-890s21c1
Sequence:GTACCGGACAATGGTAAAGTGGTTAATTCTCGAGAATTAACCACTTTACCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-330s21c1
Sequence:CCGGACTAAATTGGAGGCTGAAATTCTCGAGAATTTCAGCCTCCAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033516.4-802s21c1
Sequence:CCGGGTAACCTTGCCTGGTACTAAACTCGAGTTTAGTACCAGGCAAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-469s21c1
Sequence:CCGGTTCAGGTCTCCAACACCTATGCTCGAGCATAGGTGTTGGAGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-396s21c1
Sequence:CCGGGAACTCAAGAGGAAGTTAGGCCTCGAGGCCTAACTTCCTCTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-554s21c1
Sequence:CCGGCGTGAAGAAGTCGGCCACACTCTCGAGAGTGTGGCCGACTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-266s1c1
Sequence:CCGGCCACTCGACTTCTGAACTGGACTCGAGTCCAGTTCAGAAGTCGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-563s1c1
Sequence:CCGGGTCGGCCACACTCAGATCTTTCTCGAGAAAGATCTGAGTGTGGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-1354s1c1
Sequence:CCGGGTGCACTAATTGTTACATTACCTCGAGGTAATGTAACAATTAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.4-396s1c1
Sequence:CCGGGAACTCAAGAGGAAGTTAGGCCTCGAGGCCTAACTTCCTCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-554s1c1
Sequence:CCGGCGTGAAGAAGTCGGCCACACTCTCGAGAGTGTGGCCGACTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-484s1c1
Sequence:CCGGCCTATGTGAAACAGAAGACATCTCGAGATGTCTTCTGTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-360s1c1
Sequence:CCGGCGCCACGTACTAGCAGCCAAACTCGAGTTTGGCTGCTAGTACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-339s1c1
Sequence:CCGGGAGGCTGAAATTGTAACCCTACTCGAGTAGGGTTACAATTTCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-253s1c1
Sequence:CCGGGCACATATGAATCCCACTCGACTCGAGTCGAGTGGGATTCATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-434s1c1
Sequence:CCGGGCTGAGACAGAATCTGTCCAACTCGAGTTGGACAGATTCTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033516
VALIDATED
TPD52L3 MISSION shRNA shRNA Plasmid DNA
tumor protein D52-like 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033516.4-890s21c1
Sequence:GTACCGGACAATGGTAAAGTGGTTAATTCTCGAGAATTAACCACTTTACCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-330s21c1
Sequence:CCGGACTAAATTGGAGGCTGAAATTCTCGAGAATTTCAGCCTCCAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033516.4-802s21c1
Sequence:CCGGGTAACCTTGCCTGGTACTAAACTCGAGTTTAGTACCAGGCAAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-469s21c1
Sequence:CCGGTTCAGGTCTCCAACACCTATGCTCGAGCATAGGTGTTGGAGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-396s21c1
Sequence:CCGGGAACTCAAGAGGAAGTTAGGCCTCGAGGCCTAACTTCCTCTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-554s21c1
Sequence:CCGGCGTGAAGAAGTCGGCCACACTCTCGAGAGTGTGGCCGACTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-266s1c1
Sequence:CCGGCCACTCGACTTCTGAACTGGACTCGAGTCCAGTTCAGAAGTCGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-563s1c1
Sequence:CCGGGTCGGCCACACTCAGATCTTTCTCGAGAAAGATCTGAGTGTGGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-1354s1c1
Sequence:CCGGGTGCACTAATTGTTACATTACCTCGAGGTAATGTAACAATTAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.4-396s1c1
Sequence:CCGGGAACTCAAGAGGAAGTTAGGCCTCGAGGCCTAACTTCCTCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-554s1c1
Sequence:CCGGCGTGAAGAAGTCGGCCACACTCTCGAGAGTGTGGCCGACTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-484s1c1
Sequence:CCGGCCTATGTGAAACAGAAGACATCTCGAGATGTCTTCTGTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-360s1c1
Sequence:CCGGCGCCACGTACTAGCAGCCAAACTCGAGTTTGGCTGCTAGTACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-339s1c1
Sequence:CCGGGAGGCTGAAATTGTAACCCTACTCGAGTAGGGTTACAATTTCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-253s1c1
Sequence:CCGGGCACATATGAATCCCACTCGACTCGAGTCGAGTGGGATTCATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-434s1c1
Sequence:CCGGGCTGAGACAGAATCTGTCCAACTCGAGTTGGACAGATTCTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033516
VALIDATED
TPD52L3 MISSION shRNA Lentiviral Transduction Particles
tumor protein D52-like 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033516.4-890s21c1
Sequence:GTACCGGACAATGGTAAAGTGGTTAATTCTCGAGAATTAACCACTTTACCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-330s21c1
Sequence:CCGGACTAAATTGGAGGCTGAAATTCTCGAGAATTTCAGCCTCCAATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033516.4-802s21c1
Sequence:CCGGGTAACCTTGCCTGGTACTAAACTCGAGTTTAGTACCAGGCAAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-469s21c1
Sequence:CCGGTTCAGGTCTCCAACACCTATGCTCGAGCATAGGTGTTGGAGACCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-396s21c1
Sequence:CCGGGAACTCAAGAGGAAGTTAGGCCTCGAGGCCTAACTTCCTCTTGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033516.4-554s21c1
Sequence:CCGGCGTGAAGAAGTCGGCCACACTCTCGAGAGTGTGGCCGACTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-266s1c1
Sequence:CCGGCCACTCGACTTCTGAACTGGACTCGAGTCCAGTTCAGAAGTCGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-563s1c1
Sequence:CCGGGTCGGCCACACTCAGATCTTTCTCGAGAAAGATCTGAGTGTGGCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-1354s1c1
Sequence:CCGGGTGCACTAATTGTTACATTACCTCGAGGTAATGTAACAATTAGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.4-396s1c1
Sequence:CCGGGAACTCAAGAGGAAGTTAGGCCTCGAGGCCTAACTTCCTCTTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033516.4-554s1c1
Sequence:CCGGCGTGAAGAAGTCGGCCACACTCTCGAGAGTGTGGCCGACTTCTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-484s1c1
Sequence:CCGGCCTATGTGAAACAGAAGACATCTCGAGATGTCTTCTGTTTCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-360s1c1
Sequence:CCGGCGCCACGTACTAGCAGCCAAACTCGAGTTTGGCTGCTAGTACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-339s1c1
Sequence:CCGGGAGGCTGAAATTGTAACCCTACTCGAGTAGGGTTACAATTTCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-253s1c1
Sequence:CCGGGCACATATGAATCCCACTCGACTCGAGTCGAGTGGGATTCATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033516.2-434s1c1
Sequence:CCGGGCTGAGACAGAATCTGTCCAACTCGAGTTGGACAGATTCTGTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks