EMAIL THIS PAGE TO A FRIEND

TPGS1

tubulin polyglutamylase complex subunit 1

Synonyms: C19orf20 GTRGEO22 PGs1
UniProtKB ID: Q6ZTW0, Q96GE2
Gene ID:
Mouse(110012) tubulin polyglutamylase complex subunit 1
Rat(691093) tubulin polyglutamylase complex subunit 1
cow(505683) tubulin polyglutamylase complex subunit 1
sheep(101114106) tubulin polyglutamylase complex subunit 1
domestic guinea pig(100722760) tubulin polyglutamylase complex subunit 1
naked mole-rat(101723213) tubulin polyglutamylase complex subunit 1
chicken(100857535) tubulin polyglutamylase complex subunit 1
dog(612415) tubulin polyglutamylase complex subunit 1
domestic cat(101090238) tubulin polyglutamylase complex subunit 1
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302255 ANTI-C19ORF20 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033513 Rosetta Predictions human pricing
NM_001109621 Rosetta Predictions rat pricing
NM_148934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041864 predicted 805
2 SASI_Hs01_00041863 predicted 840
3 SASI_Hs01_00041865 predicted 332
4 SASI_Hs01_00041866 predicted 438
5 SASI_Hs01_00041867 predicted 540
6 SASI_Hs01_00041868 predicted 525
7 SASI_Hs02_00361397 predicted 810
8 SASI_Hs01_00041869 predicted 565
9 SASI_Hs02_00361398 predicted 806
10 SASI_Hs01_00041871 predicted 556
11 SASI_Hs01_00041862 predicted 1056
12 SASI_Hs01_00041870 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250162 predicted 650
2 SASI_Rn02_00250163 predicted 672
3 SASI_Rn02_00250164 predicted 807
4 SASI_Rn02_00250165 predicted 693
5 SASI_Rn02_00250166 predicted 853
6 SASI_Rn02_00250167 predicted 466
7 SASI_Rn02_00250168 predicted 884
8 SASI_Rn02_00250169 predicted 1105
9 SASI_Rn02_00250170 predicted 511
10 SASI_Rn02_00250171 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120350 predicted 231
2 SASI_Mm01_00120351 predicted 254
3 SASI_Mm01_00120352 predicted 362
4 SASI_Mm01_00120353 predicted 581
5 SASI_Mm01_00120354 predicted 232
6 SASI_Mm01_00120355 predicted 470
7 SASI_Mm01_00120356 predicted 410
8 SASI_Mm01_00120357 predicted 446
9 SASI_Mm01_00120358 predicted 652
10 SASI_Mm01_00120359 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148934
VALIDATED
TPGS1 MISSION shRNA Bacterial Glycerol Stock
tubulin polyglutamylase complex subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-225s1c1
Sequence:CCGGCATCGCCTTCTTGGCGCACTACTCGAGTAGTGCGCCAAGAAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-76s1c1
Sequence:CCGGGCGGCCAATTTCCCGGACAGTCTCGAGACTGTCCGGGAAATTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-241s1c1
Sequence:CCGGCACTACTTCGAGAACATGGGTCTCGAGACCCATGTTCTCGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-381s1c1
Sequence:CCGGCTTCAACAACAACGTGAGCGTCTCGAGACGCTCACGTTGTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-646s1c1
Sequence:CCGGCTGCTGGAGGACCCTGGTCAACTCGAGTTGACCAGGGTCCTCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-225s21c1
Sequence:CCGGCATCGCCTTCTTGGCGCACTACTCGAGTAGTGCGCCAAGAAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-573s21c1
Sequence:CCGGCATCTTCAGAACCGGCATGCTCTCGAGAGCATGCCGGTTCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-381s21c1
Sequence:CCGGCTTCAACAACAACGTGAGCGTCTCGAGACGCTCACGTTGTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-241s21c1
Sequence:CCGGCACTACTTCGAGAACATGGGTCTCGAGACCCATGTTCTCGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148934.2-66s21c1
Sequence:CCGGAGTAGCACCAGCGGCCAATTTCTCGAGAAATTGGCCGCTGGTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148934
VALIDATED
TPGS1 MISSION shRNA shRNA Plasmid DNA
tubulin polyglutamylase complex subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-225s1c1
Sequence:CCGGCATCGCCTTCTTGGCGCACTACTCGAGTAGTGCGCCAAGAAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-76s1c1
Sequence:CCGGGCGGCCAATTTCCCGGACAGTCTCGAGACTGTCCGGGAAATTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-241s1c1
Sequence:CCGGCACTACTTCGAGAACATGGGTCTCGAGACCCATGTTCTCGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-381s1c1
Sequence:CCGGCTTCAACAACAACGTGAGCGTCTCGAGACGCTCACGTTGTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-646s1c1
Sequence:CCGGCTGCTGGAGGACCCTGGTCAACTCGAGTTGACCAGGGTCCTCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-225s21c1
Sequence:CCGGCATCGCCTTCTTGGCGCACTACTCGAGTAGTGCGCCAAGAAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-573s21c1
Sequence:CCGGCATCTTCAGAACCGGCATGCTCTCGAGAGCATGCCGGTTCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-381s21c1
Sequence:CCGGCTTCAACAACAACGTGAGCGTCTCGAGACGCTCACGTTGTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-241s21c1
Sequence:CCGGCACTACTTCGAGAACATGGGTCTCGAGACCCATGTTCTCGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148934.2-66s21c1
Sequence:CCGGAGTAGCACCAGCGGCCAATTTCTCGAGAAATTGGCCGCTGGTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148934
VALIDATED
TPGS1 MISSION shRNA Lentiviral Transduction Particles
tubulin polyglutamylase complex subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-225s1c1
Sequence:CCGGCATCGCCTTCTTGGCGCACTACTCGAGTAGTGCGCCAAGAAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-76s1c1
Sequence:CCGGGCGGCCAATTTCCCGGACAGTCTCGAGACTGTCCGGGAAATTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-241s1c1
Sequence:CCGGCACTACTTCGAGAACATGGGTCTCGAGACCCATGTTCTCGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-381s1c1
Sequence:CCGGCTTCAACAACAACGTGAGCGTCTCGAGACGCTCACGTTGTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_148934.1-646s1c1
Sequence:CCGGCTGCTGGAGGACCCTGGTCAACTCGAGTTGACCAGGGTCCTCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-225s21c1
Sequence:CCGGCATCGCCTTCTTGGCGCACTACTCGAGTAGTGCGCCAAGAAGGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-573s21c1
Sequence:CCGGCATCTTCAGAACCGGCATGCTCTCGAGAGCATGCCGGTTCTGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-381s21c1
Sequence:CCGGCTTCAACAACAACGTGAGCGTCTCGAGACGCTCACGTTGTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_148934.2-241s21c1
Sequence:CCGGCACTACTTCGAGAACATGGGTCTCGAGACCCATGTTCTCGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148934.2-66s21c1
Sequence:CCGGAGTAGCACCAGCGGCCAATTTCTCGAGAAATTGGCCGCTGGTGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033513
TPGS1 MISSION shRNA Bacterial Glycerol Stock
tubulin polyglutamylase complex subunit 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1576s1c1
Sequence:CCGGCACCACCAACCAGAATCACTTCTCGAGAAGTGATTCTGGTTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1588s1c1
Sequence:CCGGGAATCACTTCTCAGACTGCAACTCGAGTTGCAGTCTGAGAAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1420s1c1
Sequence:CCGGGAAGTGCCTCATGTGATTGATCTCGAGATCAATCACATGAGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033513.1-212s1c1
Sequence:CCGGGCTCACTACTTCGAGAACATGCTCGAGCATGTTCTCGAAGTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-850s21c1
Sequence:CCGGGCTCTTCATCGCGAAGGTCAACTCGAGTTGACCTTCGCGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-202s21c1
Sequence:CCGGCGCCTTCCTGGCTCACTACTTCTCGAGAAGTAGTGAGCCAGGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-351s21c1
Sequence:CCGGCCGCCTTCAACAACAACGTGACTCGAGTCACGTTGTTGTTGAAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-562s21c1
Sequence:CCGGCACACTCACCTGCTTCGTGCTCTCGAGAGCACGAAGCAGGTGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033513
TPGS1 MISSION shRNA shRNA Plasmid DNA
tubulin polyglutamylase complex subunit 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1576s1c1
Sequence:CCGGCACCACCAACCAGAATCACTTCTCGAGAAGTGATTCTGGTTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1588s1c1
Sequence:CCGGGAATCACTTCTCAGACTGCAACTCGAGTTGCAGTCTGAGAAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1420s1c1
Sequence:CCGGGAAGTGCCTCATGTGATTGATCTCGAGATCAATCACATGAGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033513.1-212s1c1
Sequence:CCGGGCTCACTACTTCGAGAACATGCTCGAGCATGTTCTCGAAGTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-850s21c1
Sequence:CCGGGCTCTTCATCGCGAAGGTCAACTCGAGTTGACCTTCGCGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-202s21c1
Sequence:CCGGCGCCTTCCTGGCTCACTACTTCTCGAGAAGTAGTGAGCCAGGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-351s21c1
Sequence:CCGGCCGCCTTCAACAACAACGTGACTCGAGTCACGTTGTTGTTGAAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-562s21c1
Sequence:CCGGCACACTCACCTGCTTCGTGCTCTCGAGAGCACGAAGCAGGTGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033513
TPGS1 MISSION shRNA Lentiviral Transduction Particles
tubulin polyglutamylase complex subunit 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181103    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1576s1c1
Sequence:CCGGCACCACCAACCAGAATCACTTCTCGAGAAGTGATTCTGGTTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179598    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1588s1c1
Sequence:CCGGGAATCACTTCTCAGACTGCAACTCGAGTTGCAGTCTGAGAAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179375    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033513.1-1420s1c1
Sequence:CCGGGAAGTGCCTCATGTGATTGATCTCGAGATCAATCACATGAGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033513.1-212s1c1
Sequence:CCGGGCTCACTACTTCGAGAACATGCTCGAGCATGTTCTCGAAGTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-850s21c1
Sequence:CCGGGCTCTTCATCGCGAAGGTCAACTCGAGTTGACCTTCGCGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-202s21c1
Sequence:CCGGCGCCTTCCTGGCTCACTACTTCTCGAGAAGTAGTGAGCCAGGAAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-351s21c1
Sequence:CCGGCCGCCTTCAACAACAACGTGACTCGAGTCACGTTGTTGTTGAAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033513.2-562s21c1
Sequence:CCGGCACACTCACCTGCTTCGTGCTCTCGAGAGCACGAAGCAGGTGAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks