EMAIL THIS PAGE TO A FRIEND

TPGS2

tubulin polyglutamylase complex subunit 2

Synonyms: C18orf10 L17 PGs2
UniProtKB ID: Q68CL5, Q4KN59, Q8WTU3, Q96BT9, Q9Y435
Gene ID:
Human(25941) Summary: This gene encodes a protein that is a component of the neuronal polyglutamylase complex, which plays a role in post-translational addition of glutamate residues to C-terminal tubulin tails. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2012]
Mouse(66648) tubulin polyglutamylase complex subunit 2
Rat(361301) tubulin polyglutamylase complex subunit 2
Zebrafish(431755) tubulin polyglutamylase complex subunit 2
domestic cat(101095863) tubulin polyglutamylase complex subunit 2
naked mole-rat(101715623) tubulin polyglutamylase complex subunit 2
domestic guinea pig(100730937) tubulin polyglutamylase complex subunit 2
cow(540456) tubulin polyglutamylase complex subunit 2
sheep(101106644) tubulin polyglutamylase complex subunit 2
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101539 Anti-C18orf10 (121-135) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1101540 Anti-C18orf10 (236-250) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2100261 Anti-C18ORF10 (ab1) antibody produced in rabbit affinity isolated antibody human, canine, bovine, mouse, zebrafish, rat, rabbit, guinea pig, horse
western blot pricing
SAB2100262 Anti-C18ORF10 (ab2) antibody produced in rabbit affinity isolated antibody , zebrafish, bovine, guinea pig, canine, human, mouse, rat, horse, rabbit
western blot pricing
SAB1407265 Anti-C18ORF10 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306191 ANTI-TPGS2 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA040596 Anti-TPGS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA040617 Anti-TPGS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA061753 Anti-TPGS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015476 Rosetta Predictions human pricing
NM_001014147 Rosetta Predictions rat pricing
NM_001004361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208093 predicted 1147
2 SASI_Hs01_00208095 predicted 1103
3 SASI_Hs01_00208097 predicted 862
4 SASI_Hs01_00208098 predicted 1191
5 SASI_Hs01_00208099 predicted 1120
6 SASI_Hs01_00208100 predicted 1049
7 SASI_Hs01_00208101 predicted 645
8 SASI_Hs01_00208102 predicted 1064
9 SASI_Hs02_00347917 predicted 881
10 SASI_Hs02_00347918 predicted 991
11 SASI_Hs01_00208094 predicted 1179
12 SASI_Hs01_00208096 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111559 predicted 313
2 SASI_Rn01_00111560 predicted 735
3 SASI_Rn01_00111561 predicted 908
4 SASI_Rn01_00111562 predicted 513
5 SASI_Rn01_00111563 predicted 309
6 SASI_Rn01_00111564 predicted 318
7 SASI_Rn01_00111565 predicted 356
8 SASI_Rn01_00111566 predicted 706
9 SASI_Rn01_00111567 predicted 643
10 SASI_Rn01_00111568 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047919 predicted 681
2 SASI_Mm01_00047921 predicted 643
3 SASI_Mm02_00286530 predicted 532
4 SASI_Mm01_00047915 predicted 253
5 SASI_Mm01_00047916 predicted 382
6 SASI_Mm01_00047923 predicted 648
7 SASI_Mm01_00047924 predicted 589
8 SASI_Mm02_00286531 predicted 240
9 SASI_Mm02_00286532 predicted 652
10 SASI_Mm02_00286533 predicted 297
11 SASI_Mm01_00047917 predicted 921
12 SASI_Mm01_00047918 predicted 967
13 SASI_Mm01_00047920 predicted 858
14 SASI_Mm01_00047922 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004361
VALIDATED
TPGS2 MISSION shRNA Bacterial Glycerol Stock
tubulin polyglutamylase complex subunit 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-541s21c1
Sequence:CCGGGCATGGTGATTAACGGCATTTCTCGAGAAATGCCGTTAATCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004361.2-827s21c1
Sequence:CCGGGGATACCTTTACCGCCTATTACTCGAGTAATAGGCGGTAAAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004361.1-996s1c1
Sequence:CCGGCCTTTGTTTCCACTGTCATTACTCGAGTAATGACAGTGGAAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-366s21c1
Sequence:CCGGGTGACCGAGGTGAGCATAATACTCGAGTATTATGCTCACCTCGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-892s21c1
Sequence:CCGGCCTTTACCAGCTATGGCATTACTCGAGTAATGCCATAGCTGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004361.2-1915s21c1
Sequence:CCGGATAGCTCACACACCCTATATACTCGAGTATATAGGGTGTGTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004361.1-582s1c1
Sequence:CCGGCGGATACCTTTATCGCCTATTCTCGAGAATAGGCGATAAAGGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004361.1-419s1c1
Sequence:CCGGCAGCTAGAGAAGCCTCACTTTCTCGAGAAAGTGAGGCTTCTCTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004361
VALIDATED
TPGS2 MISSION shRNA shRNA Plasmid DNA
tubulin polyglutamylase complex subunit 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-541s21c1
Sequence:CCGGGCATGGTGATTAACGGCATTTCTCGAGAAATGCCGTTAATCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004361.2-827s21c1
Sequence:CCGGGGATACCTTTACCGCCTATTACTCGAGTAATAGGCGGTAAAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004361.1-996s1c1
Sequence:CCGGCCTTTGTTTCCACTGTCATTACTCGAGTAATGACAGTGGAAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-366s21c1
Sequence:CCGGGTGACCGAGGTGAGCATAATACTCGAGTATTATGCTCACCTCGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-892s21c1
Sequence:CCGGCCTTTACCAGCTATGGCATTACTCGAGTAATGCCATAGCTGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004361.2-1915s21c1
Sequence:CCGGATAGCTCACACACCCTATATACTCGAGTATATAGGGTGTGTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004361.1-582s1c1
Sequence:CCGGCGGATACCTTTATCGCCTATTCTCGAGAATAGGCGATAAAGGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004361.1-419s1c1
Sequence:CCGGCAGCTAGAGAAGCCTCACTTTCTCGAGAAAGTGAGGCTTCTCTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004361
VALIDATED
TPGS2 MISSION shRNA Lentiviral Transduction Particles
tubulin polyglutamylase complex subunit 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-541s21c1
Sequence:CCGGGCATGGTGATTAACGGCATTTCTCGAGAAATGCCGTTAATCACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004361.2-827s21c1
Sequence:CCGGGGATACCTTTACCGCCTATTACTCGAGTAATAGGCGGTAAAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004361.1-996s1c1
Sequence:CCGGCCTTTGTTTCCACTGTCATTACTCGAGTAATGACAGTGGAAACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-366s21c1
Sequence:CCGGGTGACCGAGGTGAGCATAATACTCGAGTATTATGCTCACCTCGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004361.2-892s21c1
Sequence:CCGGCCTTTACCAGCTATGGCATTACTCGAGTAATGCCATAGCTGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004361.2-1915s21c1
Sequence:CCGGATAGCTCACACACCCTATATACTCGAGTATATAGGGTGTGTGAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004361.1-582s1c1
Sequence:CCGGCGGATACCTTTATCGCCTATTCTCGAGAATAGGCGATAAAGGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004361.1-419s1c1
Sequence:CCGGCAGCTAGAGAAGCCTCACTTTCTCGAGAAAGTGAGGCTTCTCTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015476
VALIDATED
TPGS2 MISSION shRNA Bacterial Glycerol Stock
tubulin polyglutamylase complex subunit 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-425s1c1
Sequence:CCGGCCAATGGCTTCCACATGACATCTCGAGATGTCATGTGGAAGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-945s1c1
Sequence:CCGGGCTAGATCCCAGCAAAGTGTTCTCGAGAACACTTTGCTGGGATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-1058s1c1
Sequence:CCGGCCACTTCCTCCACTTCTAAATCTCGAGATTTAGAAGTGGAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-1352s1c1
Sequence:CCGGCCAAATAAGTCTGAGTGCTTTCTCGAGAAAGCACTCAGACTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-878s1c1
Sequence:CCGGGCATGTATAAACCTATCACCTCTCGAGAGGTGATAGGTTTATACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-1601s1c1
Sequence:CCGGGCACAAAGATATGGAACATTTCTCGAGAAATGTTCCATATCTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-924s1c1
Sequence:CCGGGACCGACTCCTTTGTGAATAACTCGAGTTATTCACAAAGGAGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-922s1c1
Sequence:CCGGGAGACCGACTCCTTTGTGAATCTCGAGATTCACAAAGGAGTCGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015476
VALIDATED
TPGS2 MISSION shRNA shRNA Plasmid DNA
tubulin polyglutamylase complex subunit 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-425s1c1
Sequence:CCGGCCAATGGCTTCCACATGACATCTCGAGATGTCATGTGGAAGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-945s1c1
Sequence:CCGGGCTAGATCCCAGCAAAGTGTTCTCGAGAACACTTTGCTGGGATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-1058s1c1
Sequence:CCGGCCACTTCCTCCACTTCTAAATCTCGAGATTTAGAAGTGGAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-1352s1c1
Sequence:CCGGCCAAATAAGTCTGAGTGCTTTCTCGAGAAAGCACTCAGACTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-878s1c1
Sequence:CCGGGCATGTATAAACCTATCACCTCTCGAGAGGTGATAGGTTTATACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-1601s1c1
Sequence:CCGGGCACAAAGATATGGAACATTTCTCGAGAAATGTTCCATATCTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-924s1c1
Sequence:CCGGGACCGACTCCTTTGTGAATAACTCGAGTTATTCACAAAGGAGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-922s1c1
Sequence:CCGGGAGACCGACTCCTTTGTGAATCTCGAGATTCACAAAGGAGTCGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015476
VALIDATED
TPGS2 MISSION shRNA Lentiviral Transduction Particles
tubulin polyglutamylase complex subunit 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-425s1c1
Sequence:CCGGCCAATGGCTTCCACATGACATCTCGAGATGTCATGTGGAAGCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-945s1c1
Sequence:CCGGGCTAGATCCCAGCAAAGTGTTCTCGAGAACACTTTGCTGGGATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-1058s1c1
Sequence:CCGGCCACTTCCTCCACTTCTAAATCTCGAGATTTAGAAGTGGAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-1352s1c1
Sequence:CCGGCCAAATAAGTCTGAGTGCTTTCTCGAGAAAGCACTCAGACTTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-878s1c1
Sequence:CCGGGCATGTATAAACCTATCACCTCTCGAGAGGTGATAGGTTTATACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015476.1-1601s1c1
Sequence:CCGGGCACAAAGATATGGAACATTTCTCGAGAAATGTTCCATATCTTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-924s1c1
Sequence:CCGGGACCGACTCCTTTGTGAATAACTCGAGTTATTCACAAAGGAGTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015476.1-922s1c1
Sequence:CCGGGAGACCGACTCCTTTGTGAATCTCGAGATTCACAAAGGAGTCGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks