EMAIL THIS PAGE TO A FRIEND

TPH1

tryptophan hydroxylase 1

Synonyms: TPRH TRPH
UniProtKB ID: P17752, D3DQX6, O95188, O95189, Q16736, Q3KPG8
Gene ID:
Human(7166) Summary: This gene encodes a member of the aromatic amino acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene have been associated with an elevated risk for a variety of diseases and disorders, including schizophrenia, somatic anxiety, anger-related traits, bipolar disorder, suicidal behavior, addictions, and others.[provided by RefSeq, Apr 2009]
Mouse(21990) tryptophan hydroxylase 1
Rat(24848) tryptophan hydroxylase 1
chicken(395799) tryptophan hydroxylase 1
domestic cat(101098575) tryptophan hydroxylase 1
Horse(100056614) tryptophan hydroxylase 1
dog(611956) tryptophan hydroxylase 1
cow(781941) tryptophan hydroxylase 1
sheep(101113620) tryptophan hydroxylase 1
domestic guinea pig(100718189) tryptophan hydroxylase 1
naked mole-rat(101710219) tryptophan hydroxylase 1
Domestic Rabbit(100101558) tryptophan hydroxylase 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504216 Anti-phospho-Tryptophan Hydroxylase (pSer260) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
T8825 Anti-phospho-Tryptophan Hydroxylase (pSer58) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution, sufficient for 10 blots Xenopus, rat, human, mouse
dot blot, western blot pricing
SAB4504215 Anti-phospho-Tryptophan Hydroxylase (pSer58) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB1105052 Anti-TPH1 (1-13) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105053 Anti-TPH1 (383-395) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA022483 Anti-TPH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4503029 Anti-Tryptophan Hydroxylase antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
T8575 Anti-Tryptophan Hydroxylase antibody produced in sheep affinity isolated antibody, buffered aqueous glycerol solution human, mammals
western blot pricing
SAB4503028 Anti-Tryptophan Hydroxylase, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
T0678 Monoclonal Anti-Tryptophan Hydroxylase antibody produced in mouse clone WH-3, ascites fluid rabbit, rat, human, monkey
ELISA, immunohistochemistry, microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C6506 4-Chloro-DL-phenylalanine Green Alternative human pricing
C3635 4-Chloro-DL-phenylalanine methyl ester hydrochloride human pricing
C8655 4-Chloro-L-phenylalanine human, mouse, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
T0254 L-Tryptophan reagent grade, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004179 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004179 Rosetta Predictions human pricing
NM_001100634 Rosetta Predictions rat pricing
NM_009414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146286 predicted 364
2 SASI_Hs01_00146287 predicted 865
3 SASI_Hs01_00146288 predicted 396
4 SASI_Hs01_00146289 predicted 709
5 SASI_Hs01_00146290 predicted 725
6 SASI_Hs01_00146291 predicted 609
7 SASI_Hs01_00146292 predicted 1080
8 SASI_Hs01_00146293 predicted 1108
9 SASI_Hs01_00146294 predicted 720
10 SASI_Hs01_00146295 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210158 predicted 1332
2 SASI_Rn02_00210159 predicted 1089
3 SASI_Rn02_00210160 predicted 1017
4 SASI_Rn02_00210161 predicted 789
5 SASI_Rn02_00210162 predicted 814
6 SASI_Rn02_00210163 predicted 1365
7 SASI_Rn02_00210164 predicted 1264
8 SASI_Rn02_00210165 predicted 943
9 SASI_Rn02_00210166 predicted 1321
10 SASI_Rn02_00210167 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122603 predicted 1688
2 SASI_Mm02_00316064 predicted 1778
3 SASI_Mm02_00316065 predicted 853
4 SASI_Mm01_00122605 predicted 1436
5 SASI_Mm01_00122606 predicted 1200
6 SASI_Mm01_00122607 predicted 1175
7 SASI_Mm01_00122608 predicted 1626
8 SASI_Mm01_00122609 predicted 1586
9 SASI_Mm01_00122610 predicted 600
10 SASI_Mm01_00122611 predicted 841
11 SASI_Mm01_00122604 predicted 1476
12 SASI_Mm01_00122612 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009414
TPH1 MISSION shRNA Bacterial Glycerol Stock
tryptophan hydroxylase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009414.2-1895s1c1
Sequence:CCGGCTCGCCTCTCTCCATATTCAACTCGAGTTGAATATGGAGAGAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-1458s1c1
Sequence:CCGGGTGAACTCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-1700s1c1
Sequence:CCGGGCCATGAATGAGTTGCGGTATCTCGAGATACCGCAACTCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-591s1c1
Sequence:CCGGCCCGGAAATCAAAGCAAAGAACTCGAGTTCTTTGCTTTGATTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-797s1c1
Sequence:CCGGGCCAACAGAGTGCTGTTGTATCTCGAGATACAACAGCACTCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009414
TPH1 MISSION shRNA shRNA Plasmid DNA
tryptophan hydroxylase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009414.2-1895s1c1
Sequence:CCGGCTCGCCTCTCTCCATATTCAACTCGAGTTGAATATGGAGAGAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-1458s1c1
Sequence:CCGGGTGAACTCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-1700s1c1
Sequence:CCGGGCCATGAATGAGTTGCGGTATCTCGAGATACCGCAACTCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-591s1c1
Sequence:CCGGCCCGGAAATCAAAGCAAAGAACTCGAGTTCTTTGCTTTGATTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-797s1c1
Sequence:CCGGGCCAACAGAGTGCTGTTGTATCTCGAGATACAACAGCACTCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009414
TPH1 MISSION shRNA Lentiviral Transduction Particles
tryptophan hydroxylase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120047    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009414.2-1895s1c1
Sequence:CCGGCTCGCCTCTCTCCATATTCAACTCGAGTTGAATATGGAGAGAGGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-1458s1c1
Sequence:CCGGGTGAACTCAAACATGCACTTTCTCGAGAAAGTGCATGTTTGAGTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-1700s1c1
Sequence:CCGGGCCATGAATGAGTTGCGGTATCTCGAGATACCGCAACTCATTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-591s1c1
Sequence:CCGGCCCGGAAATCAAAGCAAAGAACTCGAGTTCTTTGCTTTGATTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009414.2-797s1c1
Sequence:CCGGGCCAACAGAGTGCTGTTGTATCTCGAGATACAACAGCACTCTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004179
TPH1 MISSION shRNA Bacterial Glycerol Stock
tryptophan hydroxylase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-869s1c1
Sequence:CCGGCCCAAGAAATTGGCTTGGCTTCTCGAGAAGCCAAGCCAATTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-619s1c1
Sequence:CCGGCGGGAGGATAATATCCCACAACTCGAGTTGTGGGATATTATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-1045s1c1
Sequence:CCGGGCCAAAGTAAAGCCCTTTGATCTCGAGATCAAAGGGCTTTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-1182s1c1
Sequence:CCGGGCGTCCATTTGGAGTGAAGTACTCGAGTACTTCACTCCAAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-263s1c1
Sequence:CCGGCTGTGAATCTACCAGATAATTCTCGAGAATTATCTGGTAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004179.2-1641s21c1
Sequence:CCGGAGAAGTTGTTTGACCCAATAGCTCGAGCTATTGGGTCAAACAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004179.2-475s21c1
Sequence:CCGGACTTGGCTATGAACTATAAACCTCGAGGTTTATAGTTCATAGCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004179
TPH1 MISSION shRNA shRNA Plasmid DNA
tryptophan hydroxylase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-869s1c1
Sequence:CCGGCCCAAGAAATTGGCTTGGCTTCTCGAGAAGCCAAGCCAATTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-619s1c1
Sequence:CCGGCGGGAGGATAATATCCCACAACTCGAGTTGTGGGATATTATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-1045s1c1
Sequence:CCGGGCCAAAGTAAAGCCCTTTGATCTCGAGATCAAAGGGCTTTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-1182s1c1
Sequence:CCGGGCGTCCATTTGGAGTGAAGTACTCGAGTACTTCACTCCAAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-263s1c1
Sequence:CCGGCTGTGAATCTACCAGATAATTCTCGAGAATTATCTGGTAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004179.2-1641s21c1
Sequence:CCGGAGAAGTTGTTTGACCCAATAGCTCGAGCTATTGGGTCAAACAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004179.2-475s21c1
Sequence:CCGGACTTGGCTATGAACTATAAACCTCGAGGTTTATAGTTCATAGCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004179
TPH1 MISSION shRNA Lentiviral Transduction Particles
tryptophan hydroxylase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-869s1c1
Sequence:CCGGCCCAAGAAATTGGCTTGGCTTCTCGAGAAGCCAAGCCAATTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-619s1c1
Sequence:CCGGCGGGAGGATAATATCCCACAACTCGAGTTGTGGGATATTATCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-1045s1c1
Sequence:CCGGGCCAAAGTAAAGCCCTTTGATCTCGAGATCAAAGGGCTTTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-1182s1c1
Sequence:CCGGGCGTCCATTTGGAGTGAAGTACTCGAGTACTTCACTCCAAATGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004179.1-263s1c1
Sequence:CCGGCTGTGAATCTACCAGATAATTCTCGAGAATTATCTGGTAGATTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004179.2-1641s21c1
Sequence:CCGGAGAAGTTGTTTGACCCAATAGCTCGAGCTATTGGGTCAAACAACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004179.2-475s21c1
Sequence:CCGGACTTGGCTATGAACTATAAACCTCGAGGTTTATAGTTCATAGCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks