EMAIL THIS PAGE TO A FRIEND

TPH2

tryptophan hydroxylase 2

Synonyms: ADHD7 NTPH
UniProtKB ID: Q8IWU9, A6NGA4, Q14CB0
Gene ID:
Human(121278) Summary: This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. The human genome contains two related tryptophan hydroxylases, one on chromosome 11p15-p14 and one on chromosome 12q21. This gene is expressed predominantly in the brain stem. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Jul 2008]
Mouse(216343) tryptophan hydroxylase 2
Rat(317675) tryptophan hydroxylase 2
Zebrafish(407712) tryptophan hydroxylase 2 (tryptophan 5-monooxygenase)
domestic cat(101082165) tryptophan hydroxylase 2
Horse(100009684) tryptophan hydroxylase 2
dog(481165) tryptophan hydroxylase 2
chicken(408026) tryptophan hydroxylase 2
Domestic Rabbit(100009100) tryptophan hydroxylase 2
naked mole-rat(101714361) tryptophan hydroxylase 2
domestic guinea pig(100724594) tryptophan hydroxylase 2
cow(100336620) tryptophan hydroxylase 2
cow(618062) tryptophan hydroxylase 2
sheep(101120314) tryptophan hydroxylase 2
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301385 Anti-phospho-TPH2 (pSer19) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB2501727 Anti-TPH2 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, pig, canine, human, mouse, rat
ELISA, western blot pricing
SAB2501377 Anti-TPH2 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, bovine, pig, human
ELISA, immunohistochemistry pricing
SAB2701856 Anti-tph2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
AV34141 Anti-TPH2 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, canine, rabbit, human, rat, horse, bovine
western blot pricing
SAB2102520 Anti-TPH2 antibody produced in rabbit affinity isolated antibody horse, human, mouse, canine, rabbit, zebrafish, bovine, guinea pig, rat
western blot pricing
HPA046274 Anti-TPH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AMAB91108 Monoclonal Anti-TPH2 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2990, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry pricing
T0678 Monoclonal Anti-Tryptophan Hydroxylase antibody produced in mouse clone WH-3, ascites fluid rabbit, rat, human, monkey
ELISA, immunohistochemistry, microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C6506 4-Chloro-DL-phenylalanine Green Alternative human pricing
C3635 4-Chloro-DL-phenylalanine methyl ester hydrochloride human pricing
C8655 4-Chloro-L-phenylalanine human, mouse, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
T0254 L-Tryptophan reagent grade, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173353 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089631 MISSION® esiRNA esiRNA human TPH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173353 Rosetta Predictions human pricing
NM_173839 Rosetta Predictions rat pricing
NM_173391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368183 predicted 564
2 SASI_Hs01_00017784 predicted 1492
3 SASI_Hs01_00017785 predicted 1438
4 SASI_Hs01_00017786 predicted 833
5 SASI_Hs01_00017789 predicted 1668
6 SASI_Hs02_00368184 predicted 274
7 SASI_Hs01_00017790 predicted 678
8 SASI_Hs01_00017791 predicted 1294
9 SASI_Hs01_00017792 predicted 1624
10 SASI_Hs01_00017793 predicted 1693
11 SASI_Hs01_00017787 predicted 1179
12 SASI_Hs01_00017788 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039132 predicted 637
2 SASI_Rn01_00039133 predicted 195
3 SASI_Rn01_00039134 predicted 1168
4 SASI_Rn01_00039135 predicted 1236
5 SASI_Rn02_00269474 predicted 1341
6 SASI_Rn01_00039136 predicted 501
7 SASI_Rn01_00039137 predicted 1603
8 SASI_Rn01_00039138 predicted 1568
9 SASI_Rn01_00039139 predicted 361
10 SASI_Rn01_00039140 predicted 1667
11 SASI_Rn01_00039141 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108430 predicted 1156
2 SASI_Mm01_00108431 predicted 347
3 SASI_Mm02_00345222 predicted 356
4 SASI_Mm01_00108437 predicted 381
5 SASI_Mm01_00108434 predicted 1246
6 SASI_Mm01_00108435 predicted 1411
7 SASI_Mm02_00345223 predicted 1412
8 SASI_Mm01_00108439 predicted 1303
9 SASI_Mm02_00345224 predicted 777
10 SASI_Mm02_00345225 predicted 414
11 SASI_Mm01_00108432 predicted 1685
12 SASI_Mm01_00108433 predicted 674
13 SASI_Mm01_00108436 predicted 1704
14 SASI_Mm01_00108438 predicted 1613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173391
TPH2 MISSION shRNA Bacterial Glycerol Stock
tryptophan hydroxylase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-679s21c1
Sequence:CCGGTCGACAGAGGAGGAAGTATTTCTCGAGAAATACTTCCTCCTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-1243s21c1
Sequence:CCGGGTATGGAGCAGGGTTACTTTCCTCGAGGAAAGTAACCCTGCTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-1435s21c1
Sequence:CCGGTACCCGTCCCTTCTCGGTATACTCGAGTATACCGAGAAGGGACGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-705s21c1
Sequence:CCGGATGTGGCCATGGGCTATAAATCTCGAGATTTATAGCCCATGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-646s21c1
Sequence:CCGGTGCCGACCATCCAGGATTTAACTCGAGTTAAATCCTGGATGGTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173391.1-1655s1c1
Sequence:CCGGGCAGTCAATGTTATCCAACATCTCGAGATGTTGGATAACATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-365s1c1
Sequence:CCGGGCACTTAGACTATTCCAGGAACTCGAGTTCCTGGAATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1352s1c1
Sequence:CCGGGAATGCCTAATCACCACCTTTCTCGAGAAAGGTGGTGATTAGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1191s1c1
Sequence:CCGGCCACGTGCTATTTCTTCACAACTCGAGTTGTGAAGAAATAGCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1480s1c1
Sequence:CCGGGCAGAGCATTGAAATTCTGAACTCGAGTTCAGAATTTCAATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173391
TPH2 MISSION shRNA shRNA Plasmid DNA
tryptophan hydroxylase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-679s21c1
Sequence:CCGGTCGACAGAGGAGGAAGTATTTCTCGAGAAATACTTCCTCCTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-1243s21c1
Sequence:CCGGGTATGGAGCAGGGTTACTTTCCTCGAGGAAAGTAACCCTGCTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-1435s21c1
Sequence:CCGGTACCCGTCCCTTCTCGGTATACTCGAGTATACCGAGAAGGGACGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-705s21c1
Sequence:CCGGATGTGGCCATGGGCTATAAATCTCGAGATTTATAGCCCATGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-646s21c1
Sequence:CCGGTGCCGACCATCCAGGATTTAACTCGAGTTAAATCCTGGATGGTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173391.1-1655s1c1
Sequence:CCGGGCAGTCAATGTTATCCAACATCTCGAGATGTTGGATAACATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-365s1c1
Sequence:CCGGGCACTTAGACTATTCCAGGAACTCGAGTTCCTGGAATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1352s1c1
Sequence:CCGGGAATGCCTAATCACCACCTTTCTCGAGAAAGGTGGTGATTAGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1191s1c1
Sequence:CCGGCCACGTGCTATTTCTTCACAACTCGAGTTGTGAAGAAATAGCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1480s1c1
Sequence:CCGGGCAGAGCATTGAAATTCTGAACTCGAGTTCAGAATTTCAATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173391
TPH2 MISSION shRNA Lentiviral Transduction Particles
tryptophan hydroxylase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-679s21c1
Sequence:CCGGTCGACAGAGGAGGAAGTATTTCTCGAGAAATACTTCCTCCTCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-1243s21c1
Sequence:CCGGGTATGGAGCAGGGTTACTTTCCTCGAGGAAAGTAACCCTGCTCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-1435s21c1
Sequence:CCGGTACCCGTCCCTTCTCGGTATACTCGAGTATACCGAGAAGGGACGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-705s21c1
Sequence:CCGGATGTGGCCATGGGCTATAAATCTCGAGATTTATAGCCCATGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173391.2-646s21c1
Sequence:CCGGTGCCGACCATCCAGGATTTAACTCGAGTTAAATCCTGGATGGTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173391.1-1655s1c1
Sequence:CCGGGCAGTCAATGTTATCCAACATCTCGAGATGTTGGATAACATTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-365s1c1
Sequence:CCGGGCACTTAGACTATTCCAGGAACTCGAGTTCCTGGAATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1352s1c1
Sequence:CCGGGAATGCCTAATCACCACCTTTCTCGAGAAAGGTGGTGATTAGGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1191s1c1
Sequence:CCGGCCACGTGCTATTTCTTCACAACTCGAGTTGTGAAGAAATAGCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173391.1-1480s1c1
Sequence:CCGGGCAGAGCATTGAAATTCTGAACTCGAGTTCAGAATTTCAATGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173353
TPH2 MISSION shRNA Bacterial Glycerol Stock
tryptophan hydroxylase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173353.2-1904s1c1
Sequence:CCGGCCCTCTTATGAGTCTCATTTACTCGAGTAAATGAGACTCATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-1394s1c1
Sequence:CCGGCCTACTTTGTTTCAGAAAGTTCTCGAGAACTTTCTGAAACAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-876s1c1
Sequence:CCGGGCTGACTAAATACTGTGGCTACTCGAGTAGCCACAGTATTTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-239s1c1
Sequence:CCGGGCTCAACACTAAATAAACCTACTCGAGTAGGTTTATTTAGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-604s1c1
Sequence:CCGGCCTCGGAAGATCTCTGAGTTACTCGAGTAACTCAGAGATCTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173353
TPH2 MISSION shRNA shRNA Plasmid DNA
tryptophan hydroxylase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173353.2-1904s1c1
Sequence:CCGGCCCTCTTATGAGTCTCATTTACTCGAGTAAATGAGACTCATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-1394s1c1
Sequence:CCGGCCTACTTTGTTTCAGAAAGTTCTCGAGAACTTTCTGAAACAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-876s1c1
Sequence:CCGGGCTGACTAAATACTGTGGCTACTCGAGTAGCCACAGTATTTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-239s1c1
Sequence:CCGGGCTCAACACTAAATAAACCTACTCGAGTAGGTTTATTTAGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-604s1c1
Sequence:CCGGCCTCGGAAGATCTCTGAGTTACTCGAGTAACTCAGAGATCTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173353
TPH2 MISSION shRNA Lentiviral Transduction Particles
tryptophan hydroxylase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173353.2-1904s1c1
Sequence:CCGGCCCTCTTATGAGTCTCATTTACTCGAGTAAATGAGACTCATAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-1394s1c1
Sequence:CCGGCCTACTTTGTTTCAGAAAGTTCTCGAGAACTTTCTGAAACAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-876s1c1
Sequence:CCGGGCTGACTAAATACTGTGGCTACTCGAGTAGCCACAGTATTTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-239s1c1
Sequence:CCGGGCTCAACACTAAATAAACCTACTCGAGTAGGTTTATTTAGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173353.2-604s1c1
Sequence:CCGGCCTCGGAAGATCTCTGAGTTACTCGAGTAACTCAGAGATCTTCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks