EMAIL THIS PAGE TO A FRIEND

TPI1

triosephosphate isomerase 1

Synonyms: TIM TPI
Gene ID:
Human(7167) Summary: This gene encodes an enzyme, consisting of two identical proteins, which catalyzes the isomerization of glyceraldehydes 3-phosphate (G3P) and dihydroxy-acetone phosphate (DHAP) in glycolysis and gluconeogenesis. Mutations in this gene are associated with triosephosphate isomerase deficiency. Pseudogenes have been identified on chromosomes 1, 4, 6 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(21991) triosephosphate isomerase 1
Rat(24849) triosephosphate isomerase 1
cow(281543) triosephosphate isomerase 1
sheep(101108565) triosephosphate isomerase 1
domestic guinea pig(100724719) triosephosphate isomerase 1
naked mole-rat(101720995) triosephosphate isomerase 1
chicken(396435) triosephosphate isomerase 1
domestic cat(101085900) triosephosphate isomerase 1
dog(477711) triosephosphate isomerase 1
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000365 Rosetta Predictions human pricing
NM_022922 Rosetta Predictions rat pricing
XM_579468 Rosetta Predictions rat pricing
NM_009415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014384 predicted 630
2 SASI_Hs01_00014385 predicted 842
3 SASI_Hs01_00014386 predicted 868
4 SASI_Hs01_00014387 predicted 928
5 SASI_Hs01_00014388 predicted 909
6 SASI_Hs01_00014383 predicted 521
7 SASI_Hs01_00014389 predicted 910
8 SASI_Hs01_00014390 predicted 904
9 SASI_Hs01_00014391 predicted 1186
10 SASI_Hs01_00014392 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057307 predicted 844
2 SASI_Rn01_00057308 predicted 628
3 SASI_Rn01_00057309 predicted 1112
4 SASI_Rn01_00057310 predicted 938
5 SASI_Rn01_00057311 predicted 841
6 SASI_Rn01_00057312 predicted 737
7 SASI_Rn01_00057314 predicted 1097
8 SASI_Rn02_00263610 predicted 1092
9 SASI_Rn01_00057313 predicted 626
10 SASI_Rn02_00263611 predicted 1145
11 SASI_Rn01_00057315 predicted 1090
12 SASI_Rn01_00057316 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00184977 predicted 849
2 SASI_Rn01_00184978 predicted 624
3 SASI_Rn01_00184979 predicted 1115
4 SASI_Rn01_00184980 predicted 949
5 SASI_Rn01_00184981 predicted 846
6 SASI_Rn01_00184982 predicted 741
7 SASI_Rn01_00184983 predicted 1098
8 SASI_Rn01_00184984 predicted 1062
9 SASI_Rn01_00184985 predicted 628
10 SASI_Rn01_00184986 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118126 predicted 577
2 SASI_Mm01_00118127 predicted 1142
3 SASI_Mm02_00316066 predicted 998
4 SASI_Mm01_00118128 predicted 1072
5 SASI_Mm01_00118129 predicted 1309
6 SASI_Mm02_00316067 predicted 1007
7 SASI_Mm01_00118124 predicted 610
8 SASI_Mm01_00118130 predicted 906
9 SASI_Mm02_00316068 predicted 1221
10 SASI_Mm01_00118132 predicted 857
11 SASI_Mm01_00118123 predicted 605
12 SASI_Mm01_00118125 predicted 624
13 SASI_Mm01_00118131 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000365
VALIDATED
TPI1 MISSION shRNA Bacterial Glycerol Stock
triosephosphate isomerase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000365.3-709s1c1
Sequence:CCGGTGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-761s1c1
Sequence:CCGGGACATCATCAATGCCAAACAACTCGAGTTGTTTGGCATTGATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000365.3-166s1c1
Sequence:CCGGCCCTACTGCCTATATCGACTTCTCGAGAAGTCGATATAGGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-322s1c1
Sequence:CCGGCTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-447s1c1
Sequence:CCGGGCATCACTGAGAAGGTTGTTTCTCGAGAAACAACCTTCTCAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-713s21c1
Sequence:CCGGTGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-765s21c1
Sequence:CCGGGACATCATCAATGCCAAACAACTCGAGTTGTTTGGCATTGATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-326s21c1
Sequence:CCGGCTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-170s21c1
Sequence:CCGGCCCTACTGCCTATATCGACTTCTCGAGAAGTCGATATAGGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-451s21c1
Sequence:CCGGGCATCACTGAGAAGGTTGTTTCTCGAGAAACAACCTTCTCAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000365
VALIDATED
TPI1 MISSION shRNA shRNA Plasmid DNA
triosephosphate isomerase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000365.3-709s1c1
Sequence:CCGGTGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-761s1c1
Sequence:CCGGGACATCATCAATGCCAAACAACTCGAGTTGTTTGGCATTGATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000365.3-166s1c1
Sequence:CCGGCCCTACTGCCTATATCGACTTCTCGAGAAGTCGATATAGGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-322s1c1
Sequence:CCGGCTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-447s1c1
Sequence:CCGGGCATCACTGAGAAGGTTGTTTCTCGAGAAACAACCTTCTCAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-713s21c1
Sequence:CCGGTGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-765s21c1
Sequence:CCGGGACATCATCAATGCCAAACAACTCGAGTTGTTTGGCATTGATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-326s21c1
Sequence:CCGGCTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-170s21c1
Sequence:CCGGCCCTACTGCCTATATCGACTTCTCGAGAAGTCGATATAGGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-451s21c1
Sequence:CCGGGCATCACTGAGAAGGTTGTTTCTCGAGAAACAACCTTCTCAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000365
VALIDATED
TPI1 MISSION shRNA Lentiviral Transduction Particles
triosephosphate isomerase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000365.3-709s1c1
Sequence:CCGGTGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-761s1c1
Sequence:CCGGGACATCATCAATGCCAAACAACTCGAGTTGTTTGGCATTGATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000365.3-166s1c1
Sequence:CCGGCCCTACTGCCTATATCGACTTCTCGAGAAGTCGATATAGGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-322s1c1
Sequence:CCGGCTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000365.3-447s1c1
Sequence:CCGGGCATCACTGAGAAGGTTGTTTCTCGAGAAACAACCTTCTCAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-713s21c1
Sequence:CCGGTGATGTGGATGGCTTCCTTGTCTCGAGACAAGGAAGCCATCCACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-765s21c1
Sequence:CCGGGACATCATCAATGCCAAACAACTCGAGTTGTTTGGCATTGATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-326s21c1
Sequence:CCGGCTCAGAGAGAAGGCATGTCTTCTCGAGAAGACATGCCTTCTCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-170s21c1
Sequence:CCGGCCCTACTGCCTATATCGACTTCTCGAGAAGTCGATATAGGCAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000365.5-451s21c1
Sequence:CCGGGCATCACTGAGAAGGTTGTTTCTCGAGAAACAACCTTCTCAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009415
VALIDATED
TPI1 MISSION shRNA Bacterial Glycerol Stock
triosephosphate isomerase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-1307s1c1
Sequence:CCGGCCTGACAAGTGAAATCACCTTCTCGAGAAGGTGATTTCACTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-477s1c1
Sequence:CCGGGCCGCACAGAACTGCTACAAACTCGAGTTTGTAGCAGTTCTGTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-722s1c1
Sequence:CCGGGTTCGAGCAAACCAAGGTCATCTCGAGATGACCTTGGTTTGCTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009415.1-531s1c1
Sequence:CCGGCCTGGCATGATCAAAGACTTACTCGAGTAAGTCTTTGATCATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-423s1c1
Sequence:CCGGCCCACCGCTTACATCGACTTTCTCGAGAAAGTCGATGTAAGCGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009415.1-1307s21c1
Sequence:CCGGCCTGACAAGTGAAATCACCTTCTCGAGAAGGTGATTTCACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-722s21c1
Sequence:CCGGGTTCGAGCAAACCAAGGTCATCTCGAGATGACCTTGGTTTGCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-477s21c1
Sequence:CCGGGCCGCACAGAACTGCTACAAACTCGAGTTTGTAGCAGTTCTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-423s21c1
Sequence:CCGGCCCACCGCTTACATCGACTTTCTCGAGAAAGTCGATGTAAGCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009415
VALIDATED
TPI1 MISSION shRNA shRNA Plasmid DNA
triosephosphate isomerase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-1307s1c1
Sequence:CCGGCCTGACAAGTGAAATCACCTTCTCGAGAAGGTGATTTCACTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-477s1c1
Sequence:CCGGGCCGCACAGAACTGCTACAAACTCGAGTTTGTAGCAGTTCTGTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-722s1c1
Sequence:CCGGGTTCGAGCAAACCAAGGTCATCTCGAGATGACCTTGGTTTGCTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009415.1-531s1c1
Sequence:CCGGCCTGGCATGATCAAAGACTTACTCGAGTAAGTCTTTGATCATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-423s1c1
Sequence:CCGGCCCACCGCTTACATCGACTTTCTCGAGAAAGTCGATGTAAGCGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009415.1-1307s21c1
Sequence:CCGGCCTGACAAGTGAAATCACCTTCTCGAGAAGGTGATTTCACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-722s21c1
Sequence:CCGGGTTCGAGCAAACCAAGGTCATCTCGAGATGACCTTGGTTTGCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-477s21c1
Sequence:CCGGGCCGCACAGAACTGCTACAAACTCGAGTTTGTAGCAGTTCTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-423s21c1
Sequence:CCGGCCCACCGCTTACATCGACTTTCTCGAGAAAGTCGATGTAAGCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009415
VALIDATED
TPI1 MISSION shRNA Lentiviral Transduction Particles
triosephosphate isomerase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-1307s1c1
Sequence:CCGGCCTGACAAGTGAAATCACCTTCTCGAGAAGGTGATTTCACTTGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-477s1c1
Sequence:CCGGGCCGCACAGAACTGCTACAAACTCGAGTTTGTAGCAGTTCTGTGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-722s1c1
Sequence:CCGGGTTCGAGCAAACCAAGGTCATCTCGAGATGACCTTGGTTTGCTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009415.1-531s1c1
Sequence:CCGGCCTGGCATGATCAAAGACTTACTCGAGTAAGTCTTTGATCATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009415.1-423s1c1
Sequence:CCGGCCCACCGCTTACATCGACTTTCTCGAGAAAGTCGATGTAAGCGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009415.1-1307s21c1
Sequence:CCGGCCTGACAAGTGAAATCACCTTCTCGAGAAGGTGATTTCACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-722s21c1
Sequence:CCGGGTTCGAGCAAACCAAGGTCATCTCGAGATGACCTTGGTTTGCTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-477s21c1
Sequence:CCGGGCCGCACAGAACTGCTACAAACTCGAGTTTGTAGCAGTTCTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009415.1-423s21c1
Sequence:CCGGCCCACCGCTTACATCGACTTTCTCGAGAAAGTCGATGTAAGCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks