EMAIL THIS PAGE TO A FRIEND

TPK1

thiamin pyrophosphokinase 1

Synonyms: HTPK1 PP20 THMD5
UniProtKB ID: Q9H3S4, A8K0T7, D3DWG0, Q6NUR5, Q9H602
Gene ID:
Human(27010) Summary: This gene encodes a protein, that exists as a homodimer, which catalyzes the conversion of thiamine to thiamine pyrophosphate. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(29807) thiamine pyrophosphokinase
Rat(680668) thiamin pyrophosphokinase 1
Thale Cress(839303) thiamin pyrophosphokinase1
domestic cat(101086049) thiamin pyrophosphokinase 1
dog(475515) thiamin pyrophosphokinase 1
chicken(420780) thiamin pyrophosphokinase 1
Zebrafish(450054) thiamin pyrophosphokinase 1
cow(788066) thiamin pyrophosphokinase 1
sheep(101119979) thiamin pyrophosphokinase 1
naked mole-rat(101706194) thiamin pyrophosphokinase 1
domestic guinea pig(100718974) thiamin pyrophosphokinase 1
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013861 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013861 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013861 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022445 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042482 Rosetta Predictions human pricing
NM_022445 Rosetta Predictions human pricing
NM_001134994 Rosetta Predictions rat pricing
NM_013861 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310088 predicted 826
2 SASI_Hs02_00310089 predicted 652
3 SASI_Hs02_00310090 predicted 756
4 SASI_Hs02_00310091 predicted 731
5 SASI_Hs02_00310092 predicted 924
6 SASI_Hs02_00310093 predicted 894
7 SASI_Hs02_00310094 predicted 817
8 SASI_Hs02_00310095 predicted 804
9 SASI_Hs02_00310096 predicted 720
10 SASI_Hs02_00310097 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355698 predicted 973
2 SASI_Hs02_00355699 predicted 800
3 SASI_Hs01_00027359 predicted 900
4 SASI_Hs02_00355700 predicted 880
5 SASI_Hs02_00355701 predicted 1067
6 SASI_Hs02_00355702 predicted 1050
7 SASI_Hs02_00355703 predicted 968
8 SASI_Hs02_00355704 predicted 956
9 SASI_Hs02_00355705 predicted 860
10 SASI_Hs01_00027356 predicted 637
11 SASI_Hs01_00027357 predicted 300
12 SASI_Hs01_00027358 predicted 440
13 SASI_Hs01_00027360 predicted 390
14 SASI_Hs01_00027361 predicted 816
15 SASI_Hs01_00027362 predicted 508
16 SASI_Hs01_00027363 predicted 346
17 SASI_Hs01_00027364 predicted 666
18 SASI_Hs01_00027365 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259317 predicted 371
2 SASI_Rn02_00259318 predicted 752
3 SASI_Rn02_00259319 predicted 594
4 SASI_Rn02_00259320 predicted 607
5 SASI_Rn02_00259321 predicted 770
6 SASI_Rn02_00259322 predicted 229
7 SASI_Rn02_00259323 predicted 756
8 SASI_Rn02_00259324 predicted 705
9 SASI_Rn02_00259325 predicted 412
10 SASI_Rn02_00259326 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013861 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092506 predicted 491
2 SASI_Mm02_00322875 predicted 1026
3 SASI_Mm01_00092508 predicted 1084
4 SASI_Mm01_00092509 predicted 201
5 SASI_Mm01_00092510 predicted 1005
6 SASI_Mm02_00322876 predicted 852
7 SASI_Mm01_00092511 predicted 649
8 SASI_Mm01_00092512 predicted 487
9 SASI_Mm01_00092514 predicted 1029
10 SASI_Mm02_00322877 predicted 309
11 SASI_Mm01_00092507 predicted 863
12 SASI_Mm01_00092513 predicted 974
13 SASI_Mm01_00092515 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013861
VALIDATED
TPK1 MISSION shRNA Bacterial Glycerol Stock
thiamin pyrophosphokinase 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013861.3-131s21c1
Sequence:CCGGCAGCCTTTGGATGCACGATTTCTCGAGAAATCGTGCATCCAAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-1094s21c1
Sequence:CCGGAGCTGTATTGTATGGCTAATACTCGAGTATTAGCCATACAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-109s21c1
Sequence:CCGGATACTGCCTTGTGGTTCTTAACTCGAGTTAAGAACCACAAGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-497s21c3
Sequence:CCGGATCACTCCTGTGCCGATTATACTCGAGTATAATCGGCACAGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-283s21c1
Sequence:CCGGGCCTGAAGTCAAAGAGTACTACTCGAGTAGTACTCTTTGACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013861.3-652s21c1
Sequence:CCGGCCTGAAATGGAACCTCACAAACTCGAGTTTGTGAGGTTCCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-309s21c1
Sequence:CCGGAGAAGGGCTGTGATCTTATTTCTCGAGAAATAAGATCACAGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-1022s21c1
Sequence:CCGGATTCCAGGTAATGCTATAAATCTCGAGATTTATAGCATTACCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013861.1-284s1c1
Sequence:CCGGGCCTGAAGTCAAAGAGTACTACTCGAGTAGTACTCTTTGACTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-207s1c1
Sequence:CCGGCACTTATATGATCTCACTGAACTCGAGTTCAGTGAGATCATATAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-141s1c1
Sequence:CCGGGATGCACGATTTCGCCATCTTCTCGAGAAGATGGCGAAATCGTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-119s1c1
Sequence:CCGGTGTGGTTCTTAATCAGCCTTTCTCGAGAAAGGCTGATTAAGAACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-653s1c1
Sequence:CCGGCCTGAAATGGAACCTCACAAACTCGAGTTTGTGAGGTTCCATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013861
VALIDATED
TPK1 MISSION shRNA shRNA Plasmid DNA
thiamin pyrophosphokinase 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013861.3-131s21c1
Sequence:CCGGCAGCCTTTGGATGCACGATTTCTCGAGAAATCGTGCATCCAAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-1094s21c1
Sequence:CCGGAGCTGTATTGTATGGCTAATACTCGAGTATTAGCCATACAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-109s21c1
Sequence:CCGGATACTGCCTTGTGGTTCTTAACTCGAGTTAAGAACCACAAGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-497s21c3
Sequence:CCGGATCACTCCTGTGCCGATTATACTCGAGTATAATCGGCACAGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-283s21c1
Sequence:CCGGGCCTGAAGTCAAAGAGTACTACTCGAGTAGTACTCTTTGACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013861.3-652s21c1
Sequence:CCGGCCTGAAATGGAACCTCACAAACTCGAGTTTGTGAGGTTCCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-309s21c1
Sequence:CCGGAGAAGGGCTGTGATCTTATTTCTCGAGAAATAAGATCACAGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-1022s21c1
Sequence:CCGGATTCCAGGTAATGCTATAAATCTCGAGATTTATAGCATTACCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013861.1-284s1c1
Sequence:CCGGGCCTGAAGTCAAAGAGTACTACTCGAGTAGTACTCTTTGACTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-207s1c1
Sequence:CCGGCACTTATATGATCTCACTGAACTCGAGTTCAGTGAGATCATATAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-141s1c1
Sequence:CCGGGATGCACGATTTCGCCATCTTCTCGAGAAGATGGCGAAATCGTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-119s1c1
Sequence:CCGGTGTGGTTCTTAATCAGCCTTTCTCGAGAAAGGCTGATTAAGAACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-653s1c1
Sequence:CCGGCCTGAAATGGAACCTCACAAACTCGAGTTTGTGAGGTTCCATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013861
VALIDATED
TPK1 MISSION shRNA Lentiviral Transduction Particles
thiamin pyrophosphokinase 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013861.3-131s21c1
Sequence:CCGGCAGCCTTTGGATGCACGATTTCTCGAGAAATCGTGCATCCAAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-1094s21c1
Sequence:CCGGAGCTGTATTGTATGGCTAATACTCGAGTATTAGCCATACAATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-109s21c1
Sequence:CCGGATACTGCCTTGTGGTTCTTAACTCGAGTTAAGAACCACAAGGCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-497s21c3
Sequence:CCGGATCACTCCTGTGCCGATTATACTCGAGTATAATCGGCACAGGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-283s21c1
Sequence:CCGGGCCTGAAGTCAAAGAGTACTACTCGAGTAGTACTCTTTGACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013861.3-652s21c1
Sequence:CCGGCCTGAAATGGAACCTCACAAACTCGAGTTTGTGAGGTTCCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-309s21c1
Sequence:CCGGAGAAGGGCTGTGATCTTATTTCTCGAGAAATAAGATCACAGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013861.3-1022s21c1
Sequence:CCGGATTCCAGGTAATGCTATAAATCTCGAGATTTATAGCATTACCTGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013861.1-284s1c1
Sequence:CCGGGCCTGAAGTCAAAGAGTACTACTCGAGTAGTACTCTTTGACTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-207s1c1
Sequence:CCGGCACTTATATGATCTCACTGAACTCGAGTTCAGTGAGATCATATAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-141s1c1
Sequence:CCGGGATGCACGATTTCGCCATCTTCTCGAGAAGATGGCGAAATCGTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-119s1c1
Sequence:CCGGTGTGGTTCTTAATCAGCCTTTCTCGAGAAAGGCTGATTAAGAACCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013861.1-653s1c1
Sequence:CCGGCCTGAAATGGAACCTCACAAACTCGAGTTTGTGAGGTTCCATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022445
VALIDATED
TPK1 MISSION shRNA Bacterial Glycerol Stock
thiamin pyrophosphokinase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-642s1c1
Sequence:CCGGGTGATTGGTGTGGCCTTATTCCTCGAGGAATAAGGCCACACCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-157s1c1
Sequence:CCGGGTACTGCCTTGTAATTCTTAACTCGAGTTAAGAATTACAAGGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-327s1c1
Sequence:CCGGCAGAGAATACTATGCTACTAACTCGAGTTAGTAGCATAGTATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-728s1c1
Sequence:CCGGCATTGGTCAGTACTTCCAATACTCGAGTATTGGAAGTACTGACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022445.2-241s1c1
Sequence:CCGGCGCTTATATGATATCACCGAACTCGAGTTCGGTGATATCATATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-388s1c1
Sequence:CCGGGACTTTACTAAGTGCCTTAAACTCGAGTTTAAGGCACTTAGTAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022445.2-120s1c1
Sequence:CCGGCCTGCTTTCCACTGGGAATTTCTCGAGAAATTCCCAGTGGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022445.3-1870s1c1
Sequence:CCGGGCAGTCATAGGGCTGATAATACTCGAGTATTATCAGCCCTATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195020    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022445.3-1388s1c1
Sequence:CCGGCAAGAATCATTGACCTAATTGCTCGAGCAATTAGGTCAATGATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-572s1c1
Sequence:CCGGCAAGAGGAATCGCTGATCTACCTCGAGGTAGATCAGCGATTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022445
VALIDATED
TPK1 MISSION shRNA shRNA Plasmid DNA
thiamin pyrophosphokinase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-642s1c1
Sequence:CCGGGTGATTGGTGTGGCCTTATTCCTCGAGGAATAAGGCCACACCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-157s1c1
Sequence:CCGGGTACTGCCTTGTAATTCTTAACTCGAGTTAAGAATTACAAGGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-327s1c1
Sequence:CCGGCAGAGAATACTATGCTACTAACTCGAGTTAGTAGCATAGTATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-728s1c1
Sequence:CCGGCATTGGTCAGTACTTCCAATACTCGAGTATTGGAAGTACTGACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022445.2-241s1c1
Sequence:CCGGCGCTTATATGATATCACCGAACTCGAGTTCGGTGATATCATATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-388s1c1
Sequence:CCGGGACTTTACTAAGTGCCTTAAACTCGAGTTTAAGGCACTTAGTAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022445.2-120s1c1
Sequence:CCGGCCTGCTTTCCACTGGGAATTTCTCGAGAAATTCCCAGTGGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022445.3-1870s1c1
Sequence:CCGGGCAGTCATAGGGCTGATAATACTCGAGTATTATCAGCCCTATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195020    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022445.3-1388s1c1
Sequence:CCGGCAAGAATCATTGACCTAATTGCTCGAGCAATTAGGTCAATGATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-572s1c1
Sequence:CCGGCAAGAGGAATCGCTGATCTACCTCGAGGTAGATCAGCGATTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022445
VALIDATED
TPK1 MISSION shRNA Lentiviral Transduction Particles
thiamin pyrophosphokinase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-642s1c1
Sequence:CCGGGTGATTGGTGTGGCCTTATTCCTCGAGGAATAAGGCCACACCAATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-157s1c1
Sequence:CCGGGTACTGCCTTGTAATTCTTAACTCGAGTTAAGAATTACAAGGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-327s1c1
Sequence:CCGGCAGAGAATACTATGCTACTAACTCGAGTTAGTAGCATAGTATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-728s1c1
Sequence:CCGGCATTGGTCAGTACTTCCAATACTCGAGTATTGGAAGTACTGACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022445.2-241s1c1
Sequence:CCGGCGCTTATATGATATCACCGAACTCGAGTTCGGTGATATCATATAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_022445.2-388s1c1
Sequence:CCGGGACTTTACTAAGTGCCTTAAACTCGAGTTTAAGGCACTTAGTAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022445.2-120s1c1
Sequence:CCGGCCTGCTTTCCACTGGGAATTTCTCGAGAAATTCCCAGTGGAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197025    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022445.3-1870s1c1
Sequence:CCGGGCAGTCATAGGGCTGATAATACTCGAGTATTATCAGCCCTATGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195020    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022445.3-1388s1c1
Sequence:CCGGCAAGAATCATTGACCTAATTGCTCGAGCAATTAGGTCAATGATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022445.3-572s1c1
Sequence:CCGGCAAGAGGAATCGCTGATCTACCTCGAGGTAGATCAGCGATTCCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks