EMAIL THIS PAGE TO A FRIEND

TPM1

tropomyosin 1 (alpha)

Synonyms: C15orf13 CMD1Y CMH3 HTM-alpha LVNC9 TMSA
Gene ID:
Human(7168) Summary: This gene is a member of the tropomyosin family of highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosin is composed of two alpha-helical chains arranged as a coiled-coil. It is polymerized end to end along the two grooves of actin filaments and provides stability to the filaments. The encoded protein is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle, where it also functions in association with the troponin complex to regulate the calcium-dependent interaction of actin and myosin during muscle contraction. In smooth muscle and non-muscle cells, alternatively spliced transcript variants encoding a range of isoforms have been described. Mutations in this gene are associated with type 3 familial hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]
Mouse(22003) tropomyosin 1, alpha
Rat(24851) tropomyosin 1, alpha
Zebrafish(393908) tropomyosin 1 (alpha)
domestic cat(101091450) tropomyosin 1 (alpha)
dog(478332) tropomyosin 1 (alpha)
chicken(396366) tropomyosin 1 (alpha)
cow(281544) tropomyosin 1 (alpha)
sheep(100145865) tropomyosin 1 (alpha)
domestic guinea pig(100717160) tropomyosin 1 (alpha)
naked mole-rat(101714552) tropomyosin 1 (alpha)
310 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108542 Anti-TPM1 IgG fraction of antiserum mouse, sheep, canine, horse, mouse, rat, rabbit, guinea pig, human, bovine
immunohistochemistry, western blot pricing
HPA000261 Anti-TPM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV41392 Anti-TPM1 antibody produced in rabbit IgG fraction of antiserum zebrafish, human, guinea pig, sheep, rat, horse, rabbit, mouse, canine
immunohistochemistry, western blot pricing
SAB2102522 Anti-TPM1 antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
HPA053624 Anti-TPM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
T3651 Anti-Tropomyosin antibody produced in rabbit whole antiserum chicken
immunofluorescence, western blot pricing
T9283 Monoclonal Anti-Tropomyosin (Sarcomeric) antibody produced in mouse clone CH1, ascites fluid human, rat, chicken
immunohistochemistry, immunoprecipitation, microarray, western blot pricing
T2780 Monoclonal Anti-Tropomyosin antibody produced in mouse clone TM311, ascites fluid rabbit, pig, bovine, human, chicken, rat, mouse, hamster
ELISA, immunofluorescence, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000366 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000366 Rosetta Predictions human pricing
NM_001018004 Rosetta Predictions human pricing
NM_001018005 Rosetta Predictions human pricing
NM_001018006 Rosetta Predictions human pricing
NM_001018007 Rosetta Predictions human pricing
NM_001018008 Rosetta Predictions human pricing
NM_001018020 Rosetta Predictions human pricing
NM_001034068 Rosetta Predictions rat pricing
NM_001034069 Rosetta Predictions rat pricing
NM_001034070 Rosetta Predictions rat pricing
NM_001034071 Rosetta Predictions rat pricing
NM_001034072 Rosetta Predictions rat pricing
NM_001034073 Rosetta Predictions rat pricing
NM_001034074 Rosetta Predictions rat pricing
NM_001034075 Rosetta Predictions rat pricing
NM_019131 Rosetta Predictions rat pricing
NM_024427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081759 predicted 491
2 SASI_Hs01_00081760 predicted 460
3 SASI_Hs01_00081761 predicted 432
4 SASI_Hs01_00081762 predicted 433
5 SASI_Hs01_00081763 predicted 420
6 SASI_Hs01_00081764 predicted 432
7 SASI_Hs01_00081765 predicted 439
8 SASI_Hs01_00081766 predicted 451
9 SASI_Hs01_00081767 predicted 432
10 SASI_Hs01_00081768 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212963 predicted 1302
2 SASI_Hs01_00212964 predicted 1306
3 SASI_Hs01_00212965 predicted 1315
4 SASI_Hs01_00212966 predicted 1311
5 SASI_Hs01_00212967 predicted 1357
6 SASI_Hs01_00212968 predicted 1394
7 SASI_Hs01_00212969 predicted 1339
8 SASI_Hs01_00212970 predicted 1393
9 SASI_Hs01_00212971 predicted 1457
10 SASI_Hs01_00212972 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232257 predicted 495
2 SASI_Hs01_00232258 predicted 456
3 SASI_Hs01_00232259 predicted 434
4 SASI_Hs01_00232260 predicted 440
5 SASI_Hs01_00232261 predicted 415
6 SASI_Hs01_00232262 predicted 431
7 SASI_Hs01_00232263 predicted 433
8 SASI_Hs01_00232264 predicted 456
9 SASI_Hs01_00232265 predicted 434
10 SASI_Hs01_00232266 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071473 predicted 1305
2 SASI_Hs01_00071474 predicted 1299
3 SASI_Hs01_00071475 predicted 1315
4 SASI_Hs01_00071476 predicted 1313
5 SASI_Hs01_00071477 predicted 1351
6 SASI_Hs01_00071478 predicted 1394
7 SASI_Hs01_00071479 predicted 1336
8 SASI_Hs01_00071480 predicted 1393
9 SASI_Hs01_00071481 predicted 1460
10 SASI_Hs01_00071482 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010313 predicted 1296
2 SASI_Hs01_00010314 predicted 1298
3 SASI_Hs01_00010315 predicted 1314
4 SASI_Hs01_00010316 predicted 1315
5 SASI_Hs01_00010317 predicted 1350
6 SASI_Hs01_00010318 predicted 1385
7 SASI_Hs01_00010319 predicted 1338
8 SASI_Hs01_00010320 predicted 1396
9 SASI_Hs01_00010321 predicted 1453
10 SASI_Hs01_00010322 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081819 predicted 486
2 SASI_Hs01_00081820 predicted 526
3 SASI_Hs01_00081821 predicted 530
4 SASI_Hs01_00081822 predicted 517
5 SASI_Hs01_00081823 predicted 525
6 SASI_Hs01_00081824 predicted 549
7 SASI_Hs01_00081825 predicted 492
8 SASI_Hs02_00306899 predicted 494
9 SASI_Hs01_00081826 predicted 564
10 SASI_Hs01_00081827 predicted 489
11 SASI_Hs01_00081828 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015019 predicted 1298
2 SASI_Hs01_00015020 predicted 1302
3 SASI_Hs01_00015021 predicted 1308
4 SASI_Hs01_00015022 predicted 1315
5 SASI_Hs01_00015023 predicted 1357
6 SASI_Hs01_00015024 predicted 1393
7 SASI_Hs01_00015025 predicted 1342
8 SASI_Hs01_00015026 predicted 1393
9 SASI_Hs01_00015027 predicted 1461
10 SASI_Hs01_00015028 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064562 predicted 649
2 SASI_Rn01_00064563 predicted 561
3 SASI_Rn01_00064564 predicted 569
4 SASI_Rn01_00064565 predicted 596
5 SASI_Rn02_00203911 predicted 654
6 SASI_Rn01_00064566 predicted 566
7 SASI_Rn02_00203912 predicted 556
8 SASI_Rn01_00064568 predicted 568
9 SASI_Rn01_00064569 predicted 594
10 SASI_Rn01_00064570 predicted 568
11 SASI_Rn01_00064567 predicted 582
12 SASI_Rn01_00064571 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103991 predicted 1318
2 SASI_Rn01_00103992 predicted 1324
3 SASI_Rn01_00103993 predicted 1322
4 SASI_Rn01_00103994 predicted 1320
5 SASI_Rn02_00203913 predicted 1318
6 SASI_Rn01_00103995 predicted 1295
7 SASI_Rn01_00103996 predicted 1322
8 SASI_Rn01_00103998 predicted 1321
9 SASI_Rn01_00103999 predicted 1294
10 SASI_Rn01_00104000 predicted 1321
11 SASI_Rn01_00103997 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097699 predicted 1324
2 SASI_Rn01_00097700 predicted 1326
3 SASI_Rn01_00097701 predicted 1316
4 SASI_Rn01_00097702 predicted 1324
5 SASI_Rn02_00203914 predicted 1313
6 SASI_Rn01_00097703 predicted 1286
7 SASI_Rn01_00097704 predicted 1315
8 SASI_Rn01_00097706 predicted 1320
9 SASI_Rn01_00097707 predicted 1295
10 SASI_Rn01_00097708 predicted 1319
11 SASI_Rn01_00097705 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035571 predicted 1319
2 SASI_Rn01_00035572 predicted 1323
3 SASI_Rn01_00035573 predicted 1317
4 SASI_Rn01_00035574 predicted 1323
5 SASI_Rn02_00203915 predicted 1314
6 SASI_Rn01_00035575 predicted 1286
7 SASI_Rn01_00035576 predicted 1320
8 SASI_Rn01_00035578 predicted 1326
9 SASI_Rn01_00035579 predicted 1291
10 SASI_Rn01_00035580 predicted 1318
11 SASI_Rn01_00035577 predicted 1334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056109 predicted 257
2 SASI_Rn02_00203916 predicted 330
3 SASI_Rn01_00056110 predicted 274
4 SASI_Rn01_00056111 predicted 291
5 SASI_Rn01_00056112 predicted 251
6 SASI_Rn01_00056113 predicted 294
7 SASI_Rn01_00056114 predicted 352
8 SASI_Rn01_00056115 predicted 246
9 SASI_Rn02_00203917 predicted 332
10 SASI_Rn01_00056116 predicted 217
11 SASI_Rn01_00056117 predicted 388
12 SASI_Rn01_00056118 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203918 predicted 639
2 SASI_Rn02_00203919 predicted 506
3 SASI_Rn01_00116528 predicted 1226
4 SASI_Rn02_00203920 predicted 669
5 SASI_Rn02_00203921 predicted 761
6 SASI_Rn02_00203922 predicted 537
7 SASI_Rn02_00203923 predicted 615
8 SASI_Rn02_00203924 predicted 414
9 SASI_Rn01_00116531 predicted 1226
10 SASI_Rn02_00203925 predicted 411
11 SASI_Rn01_00116524 predicted 1259
12 SASI_Rn01_00116525 predicted 1267
13 SASI_Rn01_00116526 predicted 1261
14 SASI_Rn01_00116527 predicted 1260
15 SASI_Rn01_00116529 predicted 1256
16 SASI_Rn01_00116530 predicted 1260
17 SASI_Rn01_00116532 predicted 1210
18 SASI_Rn01_00116533 predicted 1262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065510 predicted 1258
2 SASI_Rn01_00065511 predicted 1263
3 SASI_Rn01_00065512 predicted 1254
4 SASI_Rn01_00065513 predicted 1260
5 SASI_Rn02_00203926 predicted 1258
6 SASI_Rn01_00065514 predicted 1228
7 SASI_Rn01_00065515 predicted 1258
8 SASI_Rn01_00065516 predicted 1254
9 SASI_Rn01_00065517 predicted 1234
10 SASI_Rn01_00065518 predicted 1196
11 SASI_Rn01_00065519 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033948 predicted 344
2 SASI_Rn01_00033949 predicted 268
3 SASI_Rn01_00033951 predicted 285
4 SASI_Rn02_00203927 predicted 351
5 SASI_Rn01_00033952 predicted 226
6 SASI_Rn01_00033953 predicted 258
7 SASI_Rn01_00033954 predicted 288
8 SASI_Rn01_00033956 predicted 300
9 SASI_Rn01_00033957 predicted 353
10 SASI_Rn02_00203928 predicted 266
11 SASI_Rn01_00033950 predicted 269
12 SASI_Rn01_00033955 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261867 predicted 643
2 SASI_Rn01_00075987 predicted 497
3 SASI_Rn02_00261868 predicted 666
4 SASI_Rn02_00261869 predicted 387
5 SASI_Rn02_00261870 predicted 767
6 SASI_Rn01_00075988 predicted 538
7 SASI_Rn02_00261871 predicted 584
8 SASI_Rn02_00261872 predicted 614
9 SASI_Rn02_00261873 predicted 409
10 SASI_Rn02_00261874 predicted 413
11 SASI_Rn01_00075985 predicted 585
12 SASI_Rn01_00075986 predicted 506
13 SASI_Rn01_00075989 predicted 513
14 SASI_Rn01_00075990 predicted 523
15 SASI_Rn01_00075991 predicted 512
16 SASI_Rn01_00075992 predicted 528
17 SASI_Rn01_00075993 predicted 503
18 SASI_Rn01_00075994 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134860 predicted 441
2 SASI_Mm01_00134861 predicted 326
3 SASI_Mm01_00134863 predicted 532
4 SASI_Mm01_00134864 predicted 1264
5 SASI_Mm01_00134865 predicted 577
6 SASI_Mm01_00134866 predicted 454
7 SASI_Mm01_00134868 predicted 1284
8 SASI_Mm01_00134869 predicted 452
9 SASI_Mm02_00327734 predicted 528
10 SASI_Mm02_00327735 predicted 540
11 SASI_Mm01_00134862 predicted 808
12 SASI_Mm01_00134867 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024427
VALIDATED
TPM1 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 1 (alpha)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-905s1c1
Sequence:CCGGGATCAGACTTTACTGGAGCTACTCGAGTAGCTCCAGTAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-328s1c1
Sequence:CCGGAGCTGACGTAGCTTCTCTGAACTCGAGTTCAGAGAAGCTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-678s1c1
Sequence:CCGGCGGTGACGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-548s1c1
Sequence:CCGGGAAGATGCTGACCGGAAGTATCTCGAGATACTTCCGGTCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-806s1c1
Sequence:CCGGGCAGAGAGATCAGTAACCAAACTCGAGTTTGGTTACTGATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-327s21c1
Sequence:CCGGAGCTGACGTAGCTTCTCTGAACTCGAGTTCAGAGAAGCTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-904s21c1
Sequence:CCGGGATCAGACTTTACTGGAGCTACTCGAGTAGCTCCAGTAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-547s21c1
Sequence:CCGGGAAGATGCTGACCGGAAGTATCTCGAGATACTTCCGGTCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-677s21c1
Sequence:CCGGCGGTGACGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024427
VALIDATED
TPM1 MISSION shRNA shRNA Plasmid DNA
tropomyosin 1 (alpha)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-905s1c1
Sequence:CCGGGATCAGACTTTACTGGAGCTACTCGAGTAGCTCCAGTAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-328s1c1
Sequence:CCGGAGCTGACGTAGCTTCTCTGAACTCGAGTTCAGAGAAGCTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-678s1c1
Sequence:CCGGCGGTGACGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-548s1c1
Sequence:CCGGGAAGATGCTGACCGGAAGTATCTCGAGATACTTCCGGTCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-806s1c1
Sequence:CCGGGCAGAGAGATCAGTAACCAAACTCGAGTTTGGTTACTGATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-327s21c1
Sequence:CCGGAGCTGACGTAGCTTCTCTGAACTCGAGTTCAGAGAAGCTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-904s21c1
Sequence:CCGGGATCAGACTTTACTGGAGCTACTCGAGTAGCTCCAGTAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-547s21c1
Sequence:CCGGGAAGATGCTGACCGGAAGTATCTCGAGATACTTCCGGTCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-677s21c1
Sequence:CCGGCGGTGACGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024427
VALIDATED
TPM1 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 1 (alpha)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-905s1c1
Sequence:CCGGGATCAGACTTTACTGGAGCTACTCGAGTAGCTCCAGTAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-328s1c1
Sequence:CCGGAGCTGACGTAGCTTCTCTGAACTCGAGTTCAGAGAAGCTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-678s1c1
Sequence:CCGGCGGTGACGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-548s1c1
Sequence:CCGGGAAGATGCTGACCGGAAGTATCTCGAGATACTTCCGGTCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_024427.2-806s1c1
Sequence:CCGGGCAGAGAGATCAGTAACCAAACTCGAGTTTGGTTACTGATCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-327s21c1
Sequence:CCGGAGCTGACGTAGCTTCTCTGAACTCGAGTTCAGAGAAGCTACGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-904s21c1
Sequence:CCGGGATCAGACTTTACTGGAGCTACTCGAGTAGCTCCAGTAAAGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-547s21c1
Sequence:CCGGGAAGATGCTGACCGGAAGTATCTCGAGATACTTCCGGTCAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024427.4-677s21c1
Sequence:CCGGCGGTGACGAACAACTTGAAGTCTCGAGACTTCAAGTTGTTCGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000366
VALIDATED
TPM1 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 1 (alpha)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000366.4-866s1c1
Sequence:CCGGCGGAGAGGTCAGTAACTAAATCTCGAGATTTAGTTACTGACCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-975s1c1
Sequence:CCGGCAACGATATGACTTCCATGTACTCGAGTACATGGAAGTCATATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000366.4-297s1c1
Sequence:CCGGCACCGAAGATGAACTGGACAACTCGAGTTGTCCAGTTCATCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-637s1c1
Sequence:CCGGGCCCGTAAGCTGGTCATCATTCTCGAGAATGATGACCAGCTTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-742s1c1
Sequence:CCGGGATCAGACCTTGAAAGCATTACTCGAGTAATGCTTTCAAGGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000366.5-655s21c1
Sequence:CCGGCTGAAGATGCCGACCGCAAATCTCGAGATTTGCGGTCGGCATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000366
VALIDATED
TPM1 MISSION shRNA shRNA Plasmid DNA
tropomyosin 1 (alpha)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000366.4-866s1c1
Sequence:CCGGCGGAGAGGTCAGTAACTAAATCTCGAGATTTAGTTACTGACCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-975s1c1
Sequence:CCGGCAACGATATGACTTCCATGTACTCGAGTACATGGAAGTCATATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000366.4-297s1c1
Sequence:CCGGCACCGAAGATGAACTGGACAACTCGAGTTGTCCAGTTCATCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-637s1c1
Sequence:CCGGGCCCGTAAGCTGGTCATCATTCTCGAGAATGATGACCAGCTTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-742s1c1
Sequence:CCGGGATCAGACCTTGAAAGCATTACTCGAGTAATGCTTTCAAGGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000366.5-655s21c1
Sequence:CCGGCTGAAGATGCCGACCGCAAATCTCGAGATTTGCGGTCGGCATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000366
VALIDATED
TPM1 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 1 (alpha)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000366.4-866s1c1
Sequence:CCGGCGGAGAGGTCAGTAACTAAATCTCGAGATTTAGTTACTGACCTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-975s1c1
Sequence:CCGGCAACGATATGACTTCCATGTACTCGAGTACATGGAAGTCATATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000366.4-297s1c1
Sequence:CCGGCACCGAAGATGAACTGGACAACTCGAGTTGTCCAGTTCATCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-637s1c1
Sequence:CCGGGCCCGTAAGCTGGTCATCATTCTCGAGAATGATGACCAGCTTACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000366.4-742s1c1
Sequence:CCGGGATCAGACCTTGAAAGCATTACTCGAGTAATGCTTTCAAGGTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000366.5-655s21c1
Sequence:CCGGCTGAAGATGCCGACCGCAAATCTCGAGATTTGCGGTCGGCATCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks