EMAIL THIS PAGE TO A FRIEND

TPM2

tropomyosin 2 (beta)

Synonyms: AMCD1 DA1 DA2B NEM4 TMSB
Gene ID:
Human(7169) Summary: This gene encodes beta-tropomyosin, a member of the actin filament binding protein family, and mainly expressed in slow, type 1 muscle fibers. Mutations in this gene can alter the expression of other sarcomeric tropomyosin proteins, and cause cap disease, nemaline myopathy and distal arthrogryposis syndromes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Mouse(22004) tropomyosin 2, beta
Rat(500450) tropomyosin 2, beta
naked mole-rat(101720780) tropomyosin 2 (beta)
domestic guinea pig(100730089) tropomyosin 2 (beta)
cow(497015) tropomyosin 2 (beta)
sheep(101114931) tropomyosin 2 (beta)
Zebrafish(415209) tropomyosin 2 (beta)
chicken(396430) tropomyosin 2 (beta)
domestic cat(101087790) tropomyosin 2 (beta)
dog(481598) tropomyosin 2 (beta)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48224 Anti-TPM2 antibody produced in rabbit IgG fraction of antiserum sheep, canine, bovine, mouse, guinea pig, horse, human, rat, rabbit, rabbit, zebrafish
immunohistochemistry, western blot pricing
SAB2701038 Anti-TPM2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1402380 Monoclonal Anti-TPM2 antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146201 MISSION® esiRNA esiRNA human TPM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003289 Rosetta Predictions human pricing
NM_213674 Rosetta Predictions human pricing
NM_001024345 Rosetta Predictions rat pricing
NM_009416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144649 predicted 315
2 SASI_Hs01_00144651 predicted 489
3 SASI_Hs02_00335357 predicted 549
4 SASI_Hs01_00144650 predicted 503
5 SASI_Hs01_00144654 predicted 481
6 SASI_Hs01_00144655 predicted 606
7 SASI_Hs01_00144656 predicted 732
8 SASI_Hs01_00144657 predicted 580
9 SASI_Hs02_00335358 predicted 1255
10 SASI_Hs01_00144658 predicted 700
11 SASI_Hs01_00144652 predicted 399
12 SASI_Hs01_00144653 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107903 predicted 312
2 SASI_Hs01_00107905 predicted 498
3 SASI_Hs02_00374356 predicted 546
4 SASI_Hs01_00107904 predicted 511
5 SASI_Hs01_00107908 predicted 477
6 SASI_Hs01_00107909 predicted 611
7 SASI_Hs01_00107910 predicted 735
8 SASI_Hs01_00107911 predicted 580
9 SASI_Hs01_00107912 predicted 701
10 SASI_Hs02_00374357 predicted 690
11 SASI_Hs01_00107906 predicted 393
12 SASI_Hs01_00107907 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094762 predicted 460
2 SASI_Rn01_00094763 predicted 462
3 SASI_Rn01_00094764 predicted 357
4 SASI_Rn01_00094765 predicted 321
5 SASI_Rn01_00094766 predicted 434
6 SASI_Rn01_00094767 predicted 541
7 SASI_Rn01_00094768 predicted 465
8 SASI_Rn01_00094769 predicted 731
9 SASI_Rn01_00094770 predicted 403
10 SASI_Rn01_00094771 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316069 predicted 665
2 SASI_Mm01_00069942 predicted 1377
3 SASI_Mm01_00069943 predicted 279
4 SASI_Mm01_00069944 predicted 404
5 SASI_Mm01_00069945 predicted 495
6 SASI_Mm01_00069946 predicted 1105
7 SASI_Mm01_00069948 predicted 480
8 SASI_Mm02_00316070 predicted 806
9 SASI_Mm01_00069950 predicted 750
10 SASI_Mm01_00069951 predicted 374
11 SASI_Mm01_00069947 predicted 668
12 SASI_Mm01_00069949 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213674
VALIDATED
TPM2 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 2 (beta)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-1031s21c1
Sequence:CCGGGGAGGAGAACGTCGAGATTCACTCGAGTGAATCTCGACGTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-446s21c1
Sequence:CCGGGAAACTGGAGCAGGCCGAGAACTCGAGTTCTCGGCCTGCTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-871s21c1
Sequence:CCGGAGGAGGAGTATTCCACCAAAGCTCGAGCTTTGGTGGAATACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-911s21c1
Sequence:CCGGGATCAAACTGTTGGAGGAGAACTCGAGTTCTCCTCCAACAGTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-701s1c1
Sequence:CCGGCGCTGAGGATTCAGACCGCAACTCGAGTTGCGGTCTGAATCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-416s1c1
Sequence:CCGGGTATTCTGAATCCGTGAAGGACTCGAGTCCTTCACGGATTCAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213674.1-312s1c1
Sequence:CCGGGCCGAAGCCGACAAGAAGCAACTCGAGTTGCTTCTTGTCGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-608s1c1
Sequence:CCGGCGAGAGAGGAATGAAGGTCATCTCGAGATGACCTTCATTCCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-971s1c1
Sequence:CCGGGTCTGTGGCAAAGTTGGAGAACTCGAGTTCTCCAACTTTGCCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213674
VALIDATED
TPM2 MISSION shRNA shRNA Plasmid DNA
tropomyosin 2 (beta)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-1031s21c1
Sequence:CCGGGGAGGAGAACGTCGAGATTCACTCGAGTGAATCTCGACGTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-446s21c1
Sequence:CCGGGAAACTGGAGCAGGCCGAGAACTCGAGTTCTCGGCCTGCTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-871s21c1
Sequence:CCGGAGGAGGAGTATTCCACCAAAGCTCGAGCTTTGGTGGAATACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-911s21c1
Sequence:CCGGGATCAAACTGTTGGAGGAGAACTCGAGTTCTCCTCCAACAGTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-701s1c1
Sequence:CCGGCGCTGAGGATTCAGACCGCAACTCGAGTTGCGGTCTGAATCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-416s1c1
Sequence:CCGGGTATTCTGAATCCGTGAAGGACTCGAGTCCTTCACGGATTCAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213674.1-312s1c1
Sequence:CCGGGCCGAAGCCGACAAGAAGCAACTCGAGTTGCTTCTTGTCGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-608s1c1
Sequence:CCGGCGAGAGAGGAATGAAGGTCATCTCGAGATGACCTTCATTCCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-971s1c1
Sequence:CCGGGTCTGTGGCAAAGTTGGAGAACTCGAGTTCTCCAACTTTGCCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213674
VALIDATED
TPM2 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 2 (beta)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-1031s21c1
Sequence:CCGGGGAGGAGAACGTCGAGATTCACTCGAGTGAATCTCGACGTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-446s21c1
Sequence:CCGGGAAACTGGAGCAGGCCGAGAACTCGAGTTCTCGGCCTGCTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-871s21c1
Sequence:CCGGAGGAGGAGTATTCCACCAAAGCTCGAGCTTTGGTGGAATACTCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213674.1-911s21c1
Sequence:CCGGGATCAAACTGTTGGAGGAGAACTCGAGTTCTCCTCCAACAGTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-701s1c1
Sequence:CCGGCGCTGAGGATTCAGACCGCAACTCGAGTTGCGGTCTGAATCCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-416s1c1
Sequence:CCGGGTATTCTGAATCCGTGAAGGACTCGAGTCCTTCACGGATTCAGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213674.1-312s1c1
Sequence:CCGGGCCGAAGCCGACAAGAAGCAACTCGAGTTGCTTCTTGTCGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-608s1c1
Sequence:CCGGCGAGAGAGGAATGAAGGTCATCTCGAGATGACCTTCATTCCTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_213674.1-971s1c1
Sequence:CCGGGTCTGTGGCAAAGTTGGAGAACTCGAGTTCTCCAACTTTGCCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009416
VALIDATED
TPM2 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 2 (beta)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009416.3-582s21c1
Sequence:CCGGCCGAGGTGGCTGAGAGTAAATCTCGAGATTTACTCTCAGCCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009416.3-1283s21c1
Sequence:CCGGGGCACTTTCTGATAATCAATGCTCGAGCATTGATTATCAGAAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009416.3-852s21c1
Sequence:CCGGAGCTGGACAACGCACTCAATGCTCGAGCATTGAGTGCGTTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009416.3-665s21c1
Sequence:CCGGGCGGACAAGTATTCCACCAAACTCGAGTTTGGTGGAATACTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009416.3-1348s21c1
Sequence:CCGGCACTGACCTTGGCACACTTAACTCGAGTTAAGTGTGCCAAGGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009416.3-630s21c1
Sequence:CCGGTTGTTACCAACAACTTGAAATCTCGAGATTTCAAGTTGTTGGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009416.2-1276s1c1
Sequence:CCGGCCAGCCTGTCACTTTCTGATACTCGAGTATCAGAAAGTGACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009416.2-861s1c1
Sequence:CCGGACGCACTCAATGACATCACTTCTCGAGAAGTGATGTCATTGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-497s1c1
Sequence:CCGGGCTGAGGACTCAGACCGCAAACTCGAGTTTGCGGTCTGAGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-500s1c1
Sequence:CCGGGAGGACTCAGACCGCAAATATCTCGAGATATTTGCGGTCTGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-665s1c1
Sequence:CCGGGCGGACAAGTATTCCACCAAACTCGAGTTTGGTGGAATACTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009416
VALIDATED
TPM2 MISSION shRNA shRNA Plasmid DNA
tropomyosin 2 (beta)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009416.3-582s21c1
Sequence:CCGGCCGAGGTGGCTGAGAGTAAATCTCGAGATTTACTCTCAGCCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009416.3-1283s21c1
Sequence:CCGGGGCACTTTCTGATAATCAATGCTCGAGCATTGATTATCAGAAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009416.3-852s21c1
Sequence:CCGGAGCTGGACAACGCACTCAATGCTCGAGCATTGAGTGCGTTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009416.3-665s21c1
Sequence:CCGGGCGGACAAGTATTCCACCAAACTCGAGTTTGGTGGAATACTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009416.3-1348s21c1
Sequence:CCGGCACTGACCTTGGCACACTTAACTCGAGTTAAGTGTGCCAAGGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009416.3-630s21c1
Sequence:CCGGTTGTTACCAACAACTTGAAATCTCGAGATTTCAAGTTGTTGGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009416.2-1276s1c1
Sequence:CCGGCCAGCCTGTCACTTTCTGATACTCGAGTATCAGAAAGTGACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009416.2-861s1c1
Sequence:CCGGACGCACTCAATGACATCACTTCTCGAGAAGTGATGTCATTGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-497s1c1
Sequence:CCGGGCTGAGGACTCAGACCGCAAACTCGAGTTTGCGGTCTGAGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-500s1c1
Sequence:CCGGGAGGACTCAGACCGCAAATATCTCGAGATATTTGCGGTCTGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-665s1c1
Sequence:CCGGGCGGACAAGTATTCCACCAAACTCGAGTTTGGTGGAATACTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009416
VALIDATED
TPM2 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 2 (beta)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009416.3-582s21c1
Sequence:CCGGCCGAGGTGGCTGAGAGTAAATCTCGAGATTTACTCTCAGCCACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009416.3-1283s21c1
Sequence:CCGGGGCACTTTCTGATAATCAATGCTCGAGCATTGATTATCAGAAAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009416.3-852s21c1
Sequence:CCGGAGCTGGACAACGCACTCAATGCTCGAGCATTGAGTGCGTTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009416.3-665s21c1
Sequence:CCGGGCGGACAAGTATTCCACCAAACTCGAGTTTGGTGGAATACTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009416.3-1348s21c1
Sequence:CCGGCACTGACCTTGGCACACTTAACTCGAGTTAAGTGTGCCAAGGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009416.3-630s21c1
Sequence:CCGGTTGTTACCAACAACTTGAAATCTCGAGATTTCAAGTTGTTGGTAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009416.2-1276s1c1
Sequence:CCGGCCAGCCTGTCACTTTCTGATACTCGAGTATCAGAAAGTGACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009416.2-861s1c1
Sequence:CCGGACGCACTCAATGACATCACTTCTCGAGAAGTGATGTCATTGAGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-497s1c1
Sequence:CCGGGCTGAGGACTCAGACCGCAAACTCGAGTTTGCGGTCTGAGTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-500s1c1
Sequence:CCGGGAGGACTCAGACCGCAAATATCTCGAGATATTTGCGGTCTGAGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009416.2-665s1c1
Sequence:CCGGGCGGACAAGTATTCCACCAAACTCGAGTTTGGTGGAATACTTGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks