EMAIL THIS PAGE TO A FRIEND

TPM3

tropomyosin 3

Synonyms: CAPM1 CFTD NEM1 OK/SW-cl.5 TM-5 TM3 TM30 TM30nm TM5 TPMsk3 TRK hscp30
Gene ID:
Human(7170) Summary: This gene encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(59069) tropomyosin 3, gamma
Rat(117557) tropomyosin 3
Zebrafish(373076) tropomyosin 3
domestic cat(101099019) tropomyosin 3
dog(480137) tropomyosin 3
chicken(770103) tropomyosin 3
cow(497019) tropomyosin 3
sheep(101108973) tropomyosin 3
Gene Class: Cytoskeleton
278 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001043351 Rosetta Predictions human pricing
NM_001043352 Rosetta Predictions human pricing
NM_001043353 Rosetta Predictions human pricing
NM_152263 Rosetta Predictions human pricing
NM_153649 Rosetta Predictions human pricing
NM_057208 Rosetta Predictions rat pricing
NM_173111 Rosetta Predictions rat pricing
NM_022314 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311261 predicted 225
2 SASI_Hs02_00311262 predicted 1201
3 SASI_Hs02_00311263 predicted 1075
4 SASI_Hs02_00311264 predicted 1140
5 SASI_Hs02_00311265 predicted 392
6 SASI_Hs02_00311266 predicted 620
7 SASI_Hs02_00311267 predicted 1132
8 SASI_Hs02_00311268 predicted 234
9 SASI_Hs02_00311269 predicted 392
10 SASI_Hs02_00311270 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311271 predicted 225
2 SASI_Hs02_00311272 predicted 1143
3 SASI_Hs02_00311273 predicted 888
4 SASI_Hs02_00311274 predicted 789
5 SASI_Hs02_00311275 predicted 837
6 SASI_Hs02_00311276 predicted 880
7 SASI_Hs02_00311277 predicted 1000
8 SASI_Hs02_00311278 predicted 1010
9 SASI_Hs02_00311279 predicted 866
10 SASI_Hs02_00311280 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001043353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311281 predicted 218
2 SASI_Hs02_00311282 predicted 1136
3 SASI_Hs02_00311283 predicted 891
4 SASI_Hs02_00311284 predicted 795
5 SASI_Hs02_00311285 predicted 842
6 SASI_Hs02_00311286 predicted 617
7 SASI_Hs02_00311287 predicted 885
8 SASI_Hs02_00311288 predicted 1000
9 SASI_Hs02_00311289 predicted 1013
10 SASI_Hs02_00311290 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365767 predicted 661
2 SASI_Hs02_00365768 predicted 672
3 SASI_Hs02_00365769 predicted 658
4 SASI_Hs02_00365770 predicted 663
5 SASI_Hs02_00365771 predicted 667
6 SASI_Hs01_00227641 predicted 948
7 SASI_Hs01_00227642 predicted 491
8 SASI_Hs01_00227644 predicted 715
9 SASI_Hs02_00365772 predicted 284
10 SASI_Hs02_00365773 predicted 153
11 SASI_Hs01_00227639 predicted 403
12 SASI_Hs01_00227640 predicted 740
13 SASI_Hs01_00227643 predicted 622
14 SASI_Hs01_00227645 predicted 409
15 SASI_Hs01_00227646 predicted 803
16 SASI_Hs01_00227647 predicted 417
17 SASI_Hs01_00227648 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367383 predicted 224
2 SASI_Hs02_00367384 predicted 1204
3 SASI_Hs02_00367385 predicted 1080
4 SASI_Hs02_00367386 predicted 1133
5 SASI_Hs02_00367387 predicted 388
6 SASI_Hs02_00367388 predicted 1135
7 SASI_Hs02_00367389 predicted 238
8 SASI_Hs02_00367390 predicted 389
9 SASI_Hs02_00367391 predicted 681
10 SASI_Hs01_00048992 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101123 predicted 276
2 SASI_Rn01_00101125 predicted 396
3 SASI_Rn01_00101126 predicted 694
4 SASI_Rn01_00101127 predicted 509
5 SASI_Rn01_00101128 predicted 513
6 SASI_Rn01_00101129 predicted 676
7 SASI_Rn01_00101130 predicted 247
8 SASI_Rn01_00101131 predicted 775
9 SASI_Rn01_00101132 predicted 730
10 SASI_Rn02_00267165 predicted 701
11 SASI_Rn01_00101124 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063450 predicted 324
2 SASI_Rn02_00269267 predicted 1074
3 SASI_Rn01_00063451 predicted 1070
4 SASI_Rn01_00063452 predicted 1024
5 SASI_Rn01_00063453 predicted 1024
6 SASI_Rn01_00063454 predicted 886
7 SASI_Rn01_00063455 predicted 321
8 SASI_Rn01_00063456 predicted 1056
9 SASI_Rn02_00269268 predicted 1081
10 SASI_Rn01_00063458 predicted 1038
11 SASI_Rn01_00063457 predicted 1020
12 SASI_Rn01_00063459 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129876 predicted 207
2 SASI_Mm01_00129877 predicted 211
3 SASI_Mm01_00129879 predicted 1158
4 SASI_Mm01_00129880 predicted 1098
5 SASI_Mm01_00129881 predicted 1113
6 SASI_Mm01_00129882 predicted 1165
7 SASI_Mm01_00129883 predicted 830
8 SASI_Mm01_00129884 predicted 410
9 SASI_Mm01_00129885 predicted 478
10 SASI_Mm02_00326540 predicted 505
11 SASI_Mm01_00129878 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022314
TPM3 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022314.2-1732s1c1
Sequence:CCGGCCACTGATTTAGCCACATGAACTCGAGTTCATGTGGCTAAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-539s1c1
Sequence:CCGGGCTCGTAAGTTGGTGATTATTCTCGAGAATAATCACCAACTTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-209s1c1
Sequence:CCGGGAGCTGGACAAGTATTCGGAACTCGAGTTCCGAATACTTGTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-877s1c1
Sequence:CCGGGCTGGACCTGAACGAGATGTACTCGAGTACATCTCGTTCAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-766s1c1
Sequence:CCGGTGCTGAAAGATCGGTAGCCAACTCGAGTTGGCTACCGATCTTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-164s21c1
Sequence:CCGGGATGAACTAGCAACCATGCAGCTCGAGCTGCATGGTTGCTAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-89s21c1
Sequence:CCGGGAGAATGTTCTGGACCGAGCTCTCGAGAGCTCGGTCCAGAACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-608s21c1
Sequence:CCGGCGTTGCCGAGAGATGGATGAACTCGAGTTCATCCATCTCTCGGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022314
TPM3 MISSION shRNA shRNA Plasmid DNA
tropomyosin 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022314.2-1732s1c1
Sequence:CCGGCCACTGATTTAGCCACATGAACTCGAGTTCATGTGGCTAAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-539s1c1
Sequence:CCGGGCTCGTAAGTTGGTGATTATTCTCGAGAATAATCACCAACTTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-209s1c1
Sequence:CCGGGAGCTGGACAAGTATTCGGAACTCGAGTTCCGAATACTTGTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-877s1c1
Sequence:CCGGGCTGGACCTGAACGAGATGTACTCGAGTACATCTCGTTCAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-766s1c1
Sequence:CCGGTGCTGAAAGATCGGTAGCCAACTCGAGTTGGCTACCGATCTTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-164s21c1
Sequence:CCGGGATGAACTAGCAACCATGCAGCTCGAGCTGCATGGTTGCTAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-89s21c1
Sequence:CCGGGAGAATGTTCTGGACCGAGCTCTCGAGAGCTCGGTCCAGAACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-608s21c1
Sequence:CCGGCGTTGCCGAGAGATGGATGAACTCGAGTTCATCCATCTCTCGGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022314
TPM3 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022314.2-1732s1c1
Sequence:CCGGCCACTGATTTAGCCACATGAACTCGAGTTCATGTGGCTAAATCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-539s1c1
Sequence:CCGGGCTCGTAAGTTGGTGATTATTCTCGAGAATAATCACCAACTTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-209s1c1
Sequence:CCGGGAGCTGGACAAGTATTCGGAACTCGAGTTCCGAATACTTGTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-877s1c1
Sequence:CCGGGCTGGACCTGAACGAGATGTACTCGAGTACATCTCGTTCAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022314.2-766s1c1
Sequence:CCGGTGCTGAAAGATCGGTAGCCAACTCGAGTTGGCTACCGATCTTTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-164s21c1
Sequence:CCGGGATGAACTAGCAACCATGCAGCTCGAGCTGCATGGTTGCTAGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-89s21c1
Sequence:CCGGGAGAATGTTCTGGACCGAGCTCTCGAGAGCTCGGTCCAGAACATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022314.2-608s21c1
Sequence:CCGGCGTTGCCGAGAGATGGATGAACTCGAGTTCATCCATCTCTCGGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152263
VALIDATED
TPM3 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-791s1c1
Sequence:CCGGCCTCAATGACATGACCTCTATCTCGAGATAGAGGTCATGTCATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152263.1-418s1c1
Sequence:CCGGACATTGCAGAAGAGGCAGATACTCGAGTATCTGCCTCTTCTGCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-548s1c1
Sequence:CCGGGCTGAAGAATGTCACCAACAACTCGAGTTGTTGGTGACATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-165s1c1
Sequence:CCGGGCTGAGCAGAAGCAGGCAGAACTCGAGTTCTGCCTGCTTCTGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152263.1-333s1c1
Sequence:CCGGAGAGGTATGAAGGTTATTGAACTCGAGTTCAATAACCTTCATACCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152263.2-1399s21c1
Sequence:CCGGCTCAAGCTGAACAAGATTAAACTCGAGTTTAATCTTGTTCAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-615s21c1
Sequence:CCGGCTCGTAAGTTGGTGATCATTGCTCGAGCAATGATCACCAACTTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-546s21c1
Sequence:CCGGTCCAGGAAATCCAACTCAAAGCTCGAGCTTTGAGTTGGATTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-576s21c1
Sequence:CCGGACATTGCAGAAGAGGCAGATACTCGAGTATCTGCCTCTTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-792s21c1
Sequence:CCGGTCAAGATTCTTACTGATAAACCTCGAGGTTTATCAGTAAGAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152263
VALIDATED
TPM3 MISSION shRNA shRNA Plasmid DNA
tropomyosin 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-791s1c1
Sequence:CCGGCCTCAATGACATGACCTCTATCTCGAGATAGAGGTCATGTCATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152263.1-418s1c1
Sequence:CCGGACATTGCAGAAGAGGCAGATACTCGAGTATCTGCCTCTTCTGCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-548s1c1
Sequence:CCGGGCTGAAGAATGTCACCAACAACTCGAGTTGTTGGTGACATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-165s1c1
Sequence:CCGGGCTGAGCAGAAGCAGGCAGAACTCGAGTTCTGCCTGCTTCTGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152263.1-333s1c1
Sequence:CCGGAGAGGTATGAAGGTTATTGAACTCGAGTTCAATAACCTTCATACCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152263.2-1399s21c1
Sequence:CCGGCTCAAGCTGAACAAGATTAAACTCGAGTTTAATCTTGTTCAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-615s21c1
Sequence:CCGGCTCGTAAGTTGGTGATCATTGCTCGAGCAATGATCACCAACTTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-546s21c1
Sequence:CCGGTCCAGGAAATCCAACTCAAAGCTCGAGCTTTGAGTTGGATTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-576s21c1
Sequence:CCGGACATTGCAGAAGAGGCAGATACTCGAGTATCTGCCTCTTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-792s21c1
Sequence:CCGGTCAAGATTCTTACTGATAAACCTCGAGGTTTATCAGTAAGAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152263
VALIDATED
TPM3 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-791s1c1
Sequence:CCGGCCTCAATGACATGACCTCTATCTCGAGATAGAGGTCATGTCATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152263.1-418s1c1
Sequence:CCGGACATTGCAGAAGAGGCAGATACTCGAGTATCTGCCTCTTCTGCAATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-548s1c1
Sequence:CCGGGCTGAAGAATGTCACCAACAACTCGAGTTGTTGGTGACATTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152263.1-165s1c1
Sequence:CCGGGCTGAGCAGAAGCAGGCAGAACTCGAGTTCTGCCTGCTTCTGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152263.1-333s1c1
Sequence:CCGGAGAGGTATGAAGGTTATTGAACTCGAGTTCAATAACCTTCATACCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152263.2-1399s21c1
Sequence:CCGGCTCAAGCTGAACAAGATTAAACTCGAGTTTAATCTTGTTCAGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-615s21c1
Sequence:CCGGCTCGTAAGTTGGTGATCATTGCTCGAGCAATGATCACCAACTTACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-546s21c1
Sequence:CCGGTCCAGGAAATCCAACTCAAAGCTCGAGCTTTGAGTTGGATTTCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-576s21c1
Sequence:CCGGACATTGCAGAAGAGGCAGATACTCGAGTATCTGCCTCTTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152263.2-792s21c1
Sequence:CCGGTCAAGATTCTTACTGATAAACCTCGAGGTTTATCAGTAAGAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks