EMAIL THIS PAGE TO A FRIEND

TPM3P9

tropomyosin 3 pseudogene 9

Species: Human TPM3P9(147804)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010856 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010856 Rosetta Predictions human pricing
NR_003148 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093765 predicted 490
2 SASI_Hs01_00093766 predicted 500
3 SASI_Hs01_00093767 predicted 766
4 SASI_Hs01_00093768 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378477 predicted 240
2 SASI_Hs02_00378478 predicted 661
3 SASI_Hs02_00378479 predicted 371
4 SASI_Hs02_00378480 predicted 825
5 SASI_Hs02_00378481 predicted 705
6 SASI_Hs02_00378482 predicted 822
7 SASI_Hs02_00378483 predicted 653
8 SASI_Hs02_00378484 predicted 815
9 SASI_Hs02_00378485 predicted 360
10 SASI_Hs02_00378486 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010856
TPM3P9 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 3 pseudogene 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010856.1-761s1c1
Sequence:CCGGCCTGAGGGCTGATCTTCAATTCTCGAGAATTGAAGATCAGCCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-493s1c1
Sequence:CCGGGAGAGGAAGATTCTTACTGATCTCGAGATCAGTAAGAATCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-595s1c1
Sequence:CCGGGATAAACTGAAATGCACCAAACTCGAGTTTGGTGCATTTCAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-427s1c1
Sequence:CCGGCAGAACCTGAAGTGTCTGAGTCTCGAGACTCAGACACTTCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-603s1c1
Sequence:CCGGGAAATGCACCAAAGAGGAACACTCGAGTGTTCCTCTTTGGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-657s1c1
Sequence:CCGGGCTTGACCTGAATGAGATGTACTCGAGTACATCTCATTCAGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010856
TPM3P9 MISSION shRNA shRNA Plasmid DNA
tropomyosin 3 pseudogene 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010856.1-761s1c1
Sequence:CCGGCCTGAGGGCTGATCTTCAATTCTCGAGAATTGAAGATCAGCCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-493s1c1
Sequence:CCGGGAGAGGAAGATTCTTACTGATCTCGAGATCAGTAAGAATCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-595s1c1
Sequence:CCGGGATAAACTGAAATGCACCAAACTCGAGTTTGGTGCATTTCAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-427s1c1
Sequence:CCGGCAGAACCTGAAGTGTCTGAGTCTCGAGACTCAGACACTTCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-603s1c1
Sequence:CCGGGAAATGCACCAAAGAGGAACACTCGAGTGTTCCTCTTTGGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-657s1c1
Sequence:CCGGGCTTGACCTGAATGAGATGTACTCGAGTACATCTCATTCAGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010856
TPM3P9 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 3 pseudogene 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163865    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001010856.1-761s1c1
Sequence:CCGGCCTGAGGGCTGATCTTCAATTCTCGAGAATTGAAGATCAGCCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-493s1c1
Sequence:CCGGGAGAGGAAGATTCTTACTGATCTCGAGATCAGTAAGAATCTTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-595s1c1
Sequence:CCGGGATAAACTGAAATGCACCAAACTCGAGTTTGGTGCATTTCAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-427s1c1
Sequence:CCGGCAGAACCTGAAGTGTCTGAGTCTCGAGACTCAGACACTTCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-603s1c1
Sequence:CCGGGAAATGCACCAAAGAGGAACACTCGAGTGTTCCTCTTTGGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010856.1-657s1c1
Sequence:CCGGGCTTGACCTGAATGAGATGTACTCGAGTACATCTCATTCAGGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks