EMAIL THIS PAGE TO A FRIEND

TPM4

tropomyosin 4

Gene ID:
Human(7171) Summary: This gene encodes a member of the tropomyosin family of actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. Tropomyosins are dimers of coiled-coil proteins that polymerize end-to-end along the major groove in most actin filaments. They provide stability to the filaments and regulate access of other actin-binding proteins. In muscle cells, they regulate muscle contraction by controlling the binding of myosin heads to the actin filament. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
Mouse(326618) tropomyosin 4
Rat(24852) tropomyosin 4
domestic cat(101092247) tropomyosin 4
dog(609879) tropomyosin alpha-4 chain-like
cow(535277) tropomyosin 4
sheep(101117499) tropomyosin 4
Gene Class: Cytoskeleton
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116171 MISSION® esiRNA esiRNA human TPM4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003290 Rosetta Predictions human pricing
NM_012678 Rosetta Predictions rat pricing
NM_001001491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335359 predicted 522
2 SASI_Hs02_00335360 predicted 1198
3 SASI_Hs01_00222232 predicted 417
4 SASI_Hs02_00335361 predicted 1202
5 SASI_Hs02_00335362 predicted 314
6 SASI_Hs02_00335363 predicted 305
7 SASI_Hs02_00335364 predicted 756
8 SASI_Hs02_00335365 predicted 1238
9 SASI_Hs02_00335366 predicted 760
10 SASI_Hs02_00335367 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118574 predicted 316
2 SASI_Rn01_00118576 predicted 286
3 SASI_Rn01_00118577 predicted 638
4 SASI_Rn01_00118578 predicted 316
5 SASI_Rn01_00118579 predicted 647
6 SASI_Rn01_00118581 predicted 478
7 SASI_Rn01_00118582 predicted 260
8 SASI_Rn01_00118583 predicted 532
9 SASI_Rn02_00259964 predicted 586
10 SASI_Rn02_00259965 predicted 291
11 SASI_Rn01_00118575 predicted 469
12 SASI_Rn01_00118580 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137931 predicted 506
2 SASI_Mm01_00137932 predicted 868
3 SASI_Mm01_00137933 predicted 655
4 SASI_Mm01_00137934 predicted 929
5 SASI_Mm01_00137935 predicted 467
6 SASI_Mm01_00137936 predicted 989
7 SASI_Mm01_00137937 predicted 1032
8 SASI_Mm01_00137938 predicted 761
9 SASI_Mm01_00137940 predicted 931
10 SASI_Mm02_00286173 predicted 891
11 SASI_Mm01_00137939 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003290
VALIDATED
TPM4 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-1150s1c1
Sequence:CCGGCCCAGTATCTAGTCGTGGATACTCGAGTATCCACGACTAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-80s1c1
Sequence:CCGGGAAACGCAAGATCCAGGCCCTCTCGAGAGGGCCTGGATCTTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003290.1-655s1c1
Sequence:CCGGGTGCTGAATTTGCAGAGAGAACTCGAGTTCTCTCTGCAAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-519s1c1
Sequence:CCGGCTGGAAGAAGAACTCAAGAATCTCGAGATTCTTGAGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-518s1c1
Sequence:CCGGCCTGGAAGAAGAACTCAAGAACTCGAGTTCTTGAGTTCTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-1341s21c1
Sequence:CCGGCCCAGTATCTAGTCGTGGATACTCGAGTATCCACGACTAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003290.2-710s21c1
Sequence:CCGGCTGGAAGAAGAACTCAAGAATCTCGAGATTCTTGAGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-846s21c1
Sequence:CCGGGTGCTGAATTTGCAGAGAGAACTCGAGTTCTCTCTGCAAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-958s21c1
Sequence:CCGGTCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-598s21c1
Sequence:CCGGGGAAGAGGCTGACCGCAAATACTCGAGTATTTGCGGTCAGCCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003290
VALIDATED
TPM4 MISSION shRNA shRNA Plasmid DNA
tropomyosin 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-1150s1c1
Sequence:CCGGCCCAGTATCTAGTCGTGGATACTCGAGTATCCACGACTAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-80s1c1
Sequence:CCGGGAAACGCAAGATCCAGGCCCTCTCGAGAGGGCCTGGATCTTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003290.1-655s1c1
Sequence:CCGGGTGCTGAATTTGCAGAGAGAACTCGAGTTCTCTCTGCAAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-519s1c1
Sequence:CCGGCTGGAAGAAGAACTCAAGAATCTCGAGATTCTTGAGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-518s1c1
Sequence:CCGGCCTGGAAGAAGAACTCAAGAACTCGAGTTCTTGAGTTCTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-1341s21c1
Sequence:CCGGCCCAGTATCTAGTCGTGGATACTCGAGTATCCACGACTAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003290.2-710s21c1
Sequence:CCGGCTGGAAGAAGAACTCAAGAATCTCGAGATTCTTGAGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-846s21c1
Sequence:CCGGGTGCTGAATTTGCAGAGAGAACTCGAGTTCTCTCTGCAAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-958s21c1
Sequence:CCGGTCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-598s21c1
Sequence:CCGGGGAAGAGGCTGACCGCAAATACTCGAGTATTTGCGGTCAGCCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003290
VALIDATED
TPM4 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-1150s1c1
Sequence:CCGGCCCAGTATCTAGTCGTGGATACTCGAGTATCCACGACTAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-80s1c1
Sequence:CCGGGAAACGCAAGATCCAGGCCCTCTCGAGAGGGCCTGGATCTTGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003290.1-655s1c1
Sequence:CCGGGTGCTGAATTTGCAGAGAGAACTCGAGTTCTCTCTGCAAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-519s1c1
Sequence:CCGGCTGGAAGAAGAACTCAAGAATCTCGAGATTCTTGAGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_003290.1-518s1c1
Sequence:CCGGCCTGGAAGAAGAACTCAAGAACTCGAGTTCTTGAGTTCTTCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-1341s21c1
Sequence:CCGGCCCAGTATCTAGTCGTGGATACTCGAGTATCCACGACTAGATACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003290.2-710s21c1
Sequence:CCGGCTGGAAGAAGAACTCAAGAATCTCGAGATTCTTGAGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-846s21c1
Sequence:CCGGGTGCTGAATTTGCAGAGAGAACTCGAGTTCTCTCTGCAAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-958s21c1
Sequence:CCGGTCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003290.2-598s21c1
Sequence:CCGGGGAAGAGGCTGACCGCAAATACTCGAGTATTTGCGGTCAGCCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001491
VALIDATED
TPM4 MISSION shRNA Bacterial Glycerol Stock
tropomyosin 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-470s1c1
Sequence:CCGGCGGAGGTATCTGAACTAAAGTCTCGAGACTTTAGTTCAGATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-654s1c1
Sequence:CCGGGACAGTTTCTAAACTGGAGAACTCGAGTTCTCCAGTTTAGAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-510s1c1
Sequence:CCGGGCTCAAGAATGTAACTAACAACTCGAGTTGTTAGTTACATTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-747s1c1
Sequence:CCGGCCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-1625s1c1
Sequence:CCGGGCAGCAAAGTAGTGATAGAAACTCGAGTTTCTATCACTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-470s21c1
Sequence:CCGGCGGAGGTATCTGAACTAAAGTCTCGAGACTTTAGTTCAGATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-654s21c1
Sequence:CCGGGACAGTTTCTAAACTGGAGAACTCGAGTTCTCCAGTTTAGAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001491.1-1625s21c1
Sequence:CCGGGCAGCAAAGTAGTGATAGAAACTCGAGTTTCTATCACTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-747s21c1
Sequence:CCGGCCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-510s21c1
Sequence:CCGGGCTCAAGAATGTAACTAACAACTCGAGTTGTTAGTTACATTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001491
VALIDATED
TPM4 MISSION shRNA shRNA Plasmid DNA
tropomyosin 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-470s1c1
Sequence:CCGGCGGAGGTATCTGAACTAAAGTCTCGAGACTTTAGTTCAGATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-654s1c1
Sequence:CCGGGACAGTTTCTAAACTGGAGAACTCGAGTTCTCCAGTTTAGAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-510s1c1
Sequence:CCGGGCTCAAGAATGTAACTAACAACTCGAGTTGTTAGTTACATTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-747s1c1
Sequence:CCGGCCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-1625s1c1
Sequence:CCGGGCAGCAAAGTAGTGATAGAAACTCGAGTTTCTATCACTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-470s21c1
Sequence:CCGGCGGAGGTATCTGAACTAAAGTCTCGAGACTTTAGTTCAGATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-654s21c1
Sequence:CCGGGACAGTTTCTAAACTGGAGAACTCGAGTTCTCCAGTTTAGAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001491.1-1625s21c1
Sequence:CCGGGCAGCAAAGTAGTGATAGAAACTCGAGTTTCTATCACTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-747s21c1
Sequence:CCGGCCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-510s21c1
Sequence:CCGGGCTCAAGAATGTAACTAACAACTCGAGTTGTTAGTTACATTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001491
VALIDATED
TPM4 MISSION shRNA Lentiviral Transduction Particles
tropomyosin 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-470s1c1
Sequence:CCGGCGGAGGTATCTGAACTAAAGTCTCGAGACTTTAGTTCAGATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-654s1c1
Sequence:CCGGGACAGTTTCTAAACTGGAGAACTCGAGTTCTCCAGTTTAGAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-510s1c1
Sequence:CCGGGCTCAAGAATGTAACTAACAACTCGAGTTGTTAGTTACATTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-747s1c1
Sequence:CCGGCCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001491.1-1625s1c1
Sequence:CCGGGCAGCAAAGTAGTGATAGAAACTCGAGTTTCTATCACTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-470s21c1
Sequence:CCGGCGGAGGTATCTGAACTAAAGTCTCGAGACTTTAGTTCAGATACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-654s21c1
Sequence:CCGGGACAGTTTCTAAACTGGAGAACTCGAGTTCTCCAGTTTAGAAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001491.1-1625s21c1
Sequence:CCGGGCAGCAAAGTAGTGATAGAAACTCGAGTTTCTATCACTACTTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-747s21c1
Sequence:CCGGCCAGACACTAAACGAACTTAACTCGAGTTAAGTTCGTTTAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001491.1-510s21c1
Sequence:CCGGGCTCAAGAATGTAACTAACAACTCGAGTTGTTAGTTACATTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks