EMAIL THIS PAGE TO A FRIEND

TPMT

thiopurine S-methyltransferase

Gene ID:
Human(7172) Summary: This gene encodes the enzyme that metabolizes thiopurine drugs via S-adenosyl-L-methionine as the S-methyl donor and S-adenosyl-L-homocysteine as a byproduct. Thiopurine drugs such as 6-mercaptopurine are used as chemotherapeutic agents. Genetic polymorphisms that affect this enzymatic activity are correlated with variations in sensitivity and toxicity to such drugs within individuals. A pseudogene for this locus is located on chromosome 18q. [provided by RefSeq, Jul 2008]
Mouse(22017) thiopurine methyltransferase
Rat(690050) thiopurine S-methyltransferase
chicken(420830) thiopurine S-methyltransferase
Horse(100034066) thiopurine S-methyltransferase
domestic cat(493759) thiopurine S-methyltransferase
dog(403536) thiopurine S-methyltransferase
cow(511644) thiopurine S-methyltransferase
sheep(101123418) thiopurine S-methyltransferase
Goat(100860988) thiopurine S-methyltransferase
domestic guinea pig(100722156) thiopurine S-methyltransferase
naked mole-rat(101703237) thiopurine S-methyltransferase
Domestic Rabbit(100009411) thiopurine S-methyltransferase
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000367 Rosetta Predictions human pricing
NM_001079531 Rosetta Predictions rat pricing
NM_016785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050384 predicted 312
2 SASI_Hs01_00050385 predicted 491
3 SASI_Hs02_00302416 predicted 461
4 SASI_Hs01_00050386 predicted 295
5 SASI_Hs02_00302417 predicted 556
6 SASI_Hs01_00050387 predicted 638
7 SASI_Hs01_00050388 predicted 621
8 SASI_Hs01_00050389 predicted 280
9 SASI_Hs01_00050393 predicted 689
10 SASI_Hs02_00302418 predicted 589
11 SASI_Hs01_00050390 predicted 885
12 SASI_Hs01_00050391 predicted 699
13 SASI_Hs01_00050392 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207989 predicted 330
2 SASI_Rn02_00207990 predicted 274
3 SASI_Rn02_00207991 predicted 338
4 SASI_Rn02_00207992 predicted 359
5 SASI_Rn02_00207993 predicted 514
6 SASI_Rn02_00207994 predicted 275
7 SASI_Rn02_00207995 predicted 427
8 SASI_Rn02_00207996 predicted 376
9 SASI_Rn02_00207997 predicted 297
10 SASI_Rn02_00207998 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098848 predicted 734
2 SASI_Mm01_00098849 predicted 600
3 SASI_Mm01_00098850 predicted 357
4 SASI_Mm01_00098851 predicted 289
5 SASI_Mm01_00098852 predicted 689
6 SASI_Mm01_00098853 predicted 246
7 SASI_Mm01_00098854 predicted 532
8 SASI_Mm01_00098855 predicted 540
9 SASI_Mm01_00098856 predicted 478
10 SASI_Mm01_00098857 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000367
VALIDATED
TPMT MISSION shRNA Bacterial Glycerol Stock
thiopurine S-methyltransferase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000367.2-628s21c1
Sequence:CCGGTCAATCCAGGTGATCGCAAATCTCGAGATTTGCGATCACCTGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000367.2-1136s21c1
Sequence:CCGGGCCTATGTGTCTTGCAGATTGCTCGAGCAATCTGCAAGACACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000367.2-432s21c1
Sequence:CCGGGAACTTGGGATACAAGAATTTCTCGAGAAATTCTTGTATCCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000367.2-1179s21c1
Sequence:CCGGTGTGTTACCTGTACAATTAAACTCGAGTTTAATTGTACAGGTAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000367.1-282s1c1
Sequence:CCGGGCGGTTGAGATGAAATGGTTTCTCGAGAAACCATTTCATCTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000367.1-390s1c1
Sequence:CCGGGAAGAACCAATCACCGAAATTCTCGAGAATTTCGGTGATTGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000367.1-609s1c1
Sequence:CCGGCTGTGTGTTCTTTCTTATGATCTCGAGATCATAAGAAAGAACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000367
VALIDATED
TPMT MISSION shRNA shRNA Plasmid DNA
thiopurine S-methyltransferase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000367.2-628s21c1
Sequence:CCGGTCAATCCAGGTGATCGCAAATCTCGAGATTTGCGATCACCTGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000367.2-1136s21c1
Sequence:CCGGGCCTATGTGTCTTGCAGATTGCTCGAGCAATCTGCAAGACACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000367.2-432s21c1
Sequence:CCGGGAACTTGGGATACAAGAATTTCTCGAGAAATTCTTGTATCCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000367.2-1179s21c1
Sequence:CCGGTGTGTTACCTGTACAATTAAACTCGAGTTTAATTGTACAGGTAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000367.1-282s1c1
Sequence:CCGGGCGGTTGAGATGAAATGGTTTCTCGAGAAACCATTTCATCTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000367.1-390s1c1
Sequence:CCGGGAAGAACCAATCACCGAAATTCTCGAGAATTTCGGTGATTGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000367.1-609s1c1
Sequence:CCGGCTGTGTGTTCTTTCTTATGATCTCGAGATCATAAGAAAGAACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000367
VALIDATED
TPMT MISSION shRNA Lentiviral Transduction Particles
thiopurine S-methyltransferase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000367.2-628s21c1
Sequence:CCGGTCAATCCAGGTGATCGCAAATCTCGAGATTTGCGATCACCTGGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000367.2-1136s21c1
Sequence:CCGGGCCTATGTGTCTTGCAGATTGCTCGAGCAATCTGCAAGACACATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000367.2-432s21c1
Sequence:CCGGGAACTTGGGATACAAGAATTTCTCGAGAAATTCTTGTATCCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000367.2-1179s21c1
Sequence:CCGGTGTGTTACCTGTACAATTAAACTCGAGTTTAATTGTACAGGTAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000367.1-282s1c1
Sequence:CCGGGCGGTTGAGATGAAATGGTTTCTCGAGAAACCATTTCATCTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000367.1-390s1c1
Sequence:CCGGGAAGAACCAATCACCGAAATTCTCGAGAATTTCGGTGATTGGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000367.1-609s1c1
Sequence:CCGGCTGTGTGTTCTTTCTTATGATCTCGAGATCATAAGAAAGAACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016785
VALIDATED
TPMT MISSION shRNA Bacterial Glycerol Stock
thiopurine S-methyltransferase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-805s21c1
Sequence:CCGGGCTTTGGAAGAAAGGCATAAACTCGAGTTTATGCCTTTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-269s21c1
Sequence:CCGGAGCAAGGGCATCAGCTATTAACTCGAGTTAATAGCTGATGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.1-889s21c1
Sequence:CCGGCTGGTAGTGGAGCACACCTTTCTCGAGAAAGGTGTGCTCCACTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.1-689s21c1
Sequence:CCGGCTGTCCTTTCTTATGATCCAACTCGAGTTGGATCATAAGAAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-478s21c1
Sequence:CCGGGCCGAAATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.2-544s21c1
Sequence:CCGGTATACTGCTGCAGCATATTTGCTCGAGCAAATATGCTGCAGCAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016785.2-1374s21c1
Sequence:CCGGCTAAGCTGTCAGTGCTAAATACTCGAGTATTTAGCACTGACAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-539s1c1
Sequence:CCGGGCAGCATATTTGATCTTCCTACTCGAGTAGGAAGATCAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-477s1c1
Sequence:CCGGCGCCGAAATTGCTGGAGCCAACTCGAGTTGGCTCCAGCAATTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016785.1-805s1c1
Sequence:CCGGGCTTTGGAAGAAAGGCATAAACTCGAGTTTATGCCTTTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016785.1-689s1c1
Sequence:CCGGCTGTCCTTTCTTATGATCCAACTCGAGTTGGATCATAAGAAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-478s1c1
Sequence:CCGGGCCGAAATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016785
VALIDATED
TPMT MISSION shRNA shRNA Plasmid DNA
thiopurine S-methyltransferase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-805s21c1
Sequence:CCGGGCTTTGGAAGAAAGGCATAAACTCGAGTTTATGCCTTTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-269s21c1
Sequence:CCGGAGCAAGGGCATCAGCTATTAACTCGAGTTAATAGCTGATGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.1-889s21c1
Sequence:CCGGCTGGTAGTGGAGCACACCTTTCTCGAGAAAGGTGTGCTCCACTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.1-689s21c1
Sequence:CCGGCTGTCCTTTCTTATGATCCAACTCGAGTTGGATCATAAGAAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-478s21c1
Sequence:CCGGGCCGAAATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.2-544s21c1
Sequence:CCGGTATACTGCTGCAGCATATTTGCTCGAGCAAATATGCTGCAGCAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016785.2-1374s21c1
Sequence:CCGGCTAAGCTGTCAGTGCTAAATACTCGAGTATTTAGCACTGACAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-539s1c1
Sequence:CCGGGCAGCATATTTGATCTTCCTACTCGAGTAGGAAGATCAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-477s1c1
Sequence:CCGGCGCCGAAATTGCTGGAGCCAACTCGAGTTGGCTCCAGCAATTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016785.1-805s1c1
Sequence:CCGGGCTTTGGAAGAAAGGCATAAACTCGAGTTTATGCCTTTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016785.1-689s1c1
Sequence:CCGGCTGTCCTTTCTTATGATCCAACTCGAGTTGGATCATAAGAAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-478s1c1
Sequence:CCGGGCCGAAATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016785
VALIDATED
TPMT MISSION shRNA Lentiviral Transduction Particles
thiopurine S-methyltransferase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-805s21c1
Sequence:CCGGGCTTTGGAAGAAAGGCATAAACTCGAGTTTATGCCTTTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-269s21c1
Sequence:CCGGAGCAAGGGCATCAGCTATTAACTCGAGTTAATAGCTGATGCCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305342    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.1-889s21c1
Sequence:CCGGCTGGTAGTGGAGCACACCTTTCTCGAGAAAGGTGTGCTCCACTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.1-689s21c1
Sequence:CCGGCTGTCCTTTCTTATGATCCAACTCGAGTTGGATCATAAGAAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016785.1-478s21c1
Sequence:CCGGGCCGAAATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016785.2-544s21c1
Sequence:CCGGTATACTGCTGCAGCATATTTGCTCGAGCAAATATGCTGCAGCAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016785.2-1374s21c1
Sequence:CCGGCTAAGCTGTCAGTGCTAAATACTCGAGTATTTAGCACTGACAGCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-539s1c1
Sequence:CCGGGCAGCATATTTGATCTTCCTACTCGAGTAGGAAGATCAAATATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-477s1c1
Sequence:CCGGCGCCGAAATTGCTGGAGCCAACTCGAGTTGGCTCCAGCAATTTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016785.1-805s1c1
Sequence:CCGGGCTTTGGAAGAAAGGCATAAACTCGAGTTTATGCCTTTCTTCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016785.1-689s1c1
Sequence:CCGGCTGTCCTTTCTTATGATCCAACTCGAGTTGGATCATAAGAAAGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016785.1-478s1c1
Sequence:CCGGGCCGAAATTGCTGGAGCCAAACTCGAGTTTGGCTCCAGCAATTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks