EMAIL THIS PAGE TO A FRIEND

TPP1

tripeptidyl peptidase I

Synonyms: CLN2 LPIC TPP-1
UniProtKB ID: O14773, Q53HT1, Q5JAK6, Q6UX56, Q71JP6, Q96C37
Gene ID:
Human(1200) Summary: This gene encodes a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. Mutations in this gene result in late-infantile neuronal ceroid lipofuscinosis, which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. [provided by RefSeq, Jul 2008]
Mouse(12751) tripeptidyl peptidase I
Rat(83534) tripeptidyl peptidase I
Zebrafish(798347) tripeptidyl peptidase I
domestic cat(101093296) tripeptidyl peptidase I
chicken(425576) tripeptidyl peptidase I
dog(485337) tripeptidyl peptidase I
domestic guinea pig(100733945) tripeptidyl peptidase I
naked mole-rat(101707185) tripeptidyl peptidase I
Domestic Rabbit(100356773) tripeptidyl peptidase I
cow(515575) tripeptidyl peptidase I
sheep(101116858) tripeptidyl peptidase I
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000391 Rosetta Predictions human pricing
NM_031357 Rosetta Predictions rat pricing
NM_009906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135550 predicted 1239
2 SASI_Hs01_00135551 predicted 880
3 SASI_Hs02_00302461 predicted 413
4 SASI_Hs01_00135554 predicted 661
5 SASI_Hs01_00135555 predicted 861
6 SASI_Hs01_00135557 predicted 474
7 SASI_Hs02_00302462 predicted 1031
8 SASI_Hs01_00135558 predicted 458
9 SASI_Hs01_00135559 predicted 1254
10 SASI_Hs02_00302463 predicted 1060
11 SASI_Hs01_00135552 predicted 722
12 SASI_Hs01_00135553 predicted 783
13 SASI_Hs01_00135556 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039243 predicted 1775
2 SASI_Rn02_00264615 predicted 543
3 SASI_Rn01_00039244 predicted 227
4 SASI_Rn01_00039245 predicted 1017
5 SASI_Rn02_00264616 predicted 1754
6 SASI_Rn01_00039247 predicted 1770
7 SASI_Rn02_00264617 predicted 939
8 SASI_Rn01_00039249 predicted 840
9 SASI_Rn01_00039250 predicted 982
10 SASI_Rn01_00039251 predicted 723
11 SASI_Rn01_00039246 predicted 1195
12 SASI_Rn01_00039248 predicted 1458
13 SASI_Rn01_00039252 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076851 predicted 837
2 SASI_Mm01_00076852 predicted 449
3 SASI_Mm01_00076853 predicted 227
4 SASI_Mm01_00076856 predicted 1208
5 SASI_Mm01_00076857 predicted 1709
6 SASI_Mm02_00317422 predicted 920
7 SASI_Mm01_00076858 predicted 982
8 SASI_Mm01_00076859 predicted 1332
9 SASI_Mm02_00317423 predicted 710
10 SASI_Mm01_00076860 predicted 1553
11 SASI_Mm01_00076854 predicted 853
12 SASI_Mm01_00076855 predicted 1323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000391
VALIDATED
TPP1 MISSION shRNA Bacterial Glycerol Stock
tripeptidyl peptidase I
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000391.3-1797s21c1
Sequence:CCGGTGGCAGTTCAGTCCCTTATTCCTCGAGGAATAAGGGACTGAACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000391.3-1509s21c1
Sequence:CCGGGGATCCTATCCTTGATCAATGCTCGAGCATTGATCAAGGATAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000391.3-2059s21c1
Sequence:CCGGACAGACTCTGTGCACTATTTCCTCGAGGAAATAGTGCACAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000391.x-270s1c1
Sequence:CCGGACCCTAGAGAATGTGGCTGATCTCGAGATCAGCCACATTCTCTAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000391.x-792s1c1
Sequence:CCGGGCATCAGTAGCCCGTGTGGTTCTCGAGAACCACACGGGCTACTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-3179s1c1
Sequence:CCGGCCTCGTCTGTTAAGTGTGAATCTCGAGATTCACACTTAACAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-1000s1c1
Sequence:CCGGGCTATGGAGATGATGAGGACTCTCGAGAGTCCTCATCATCTCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-633s1c1
Sequence:CCGGCCCTCTGTGATCCGTAAGCGACTCGAGTCGCTTACGGATCACAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000391
VALIDATED
TPP1 MISSION shRNA shRNA Plasmid DNA
tripeptidyl peptidase I
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000391.3-1797s21c1
Sequence:CCGGTGGCAGTTCAGTCCCTTATTCCTCGAGGAATAAGGGACTGAACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000391.3-1509s21c1
Sequence:CCGGGGATCCTATCCTTGATCAATGCTCGAGCATTGATCAAGGATAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000391.3-2059s21c1
Sequence:CCGGACAGACTCTGTGCACTATTTCCTCGAGGAAATAGTGCACAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000391.x-270s1c1
Sequence:CCGGACCCTAGAGAATGTGGCTGATCTCGAGATCAGCCACATTCTCTAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000391.x-792s1c1
Sequence:CCGGGCATCAGTAGCCCGTGTGGTTCTCGAGAACCACACGGGCTACTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-3179s1c1
Sequence:CCGGCCTCGTCTGTTAAGTGTGAATCTCGAGATTCACACTTAACAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-1000s1c1
Sequence:CCGGGCTATGGAGATGATGAGGACTCTCGAGAGTCCTCATCATCTCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-633s1c1
Sequence:CCGGCCCTCTGTGATCCGTAAGCGACTCGAGTCGCTTACGGATCACAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000391
VALIDATED
TPP1 MISSION shRNA Lentiviral Transduction Particles
tripeptidyl peptidase I
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000391.3-1797s21c1
Sequence:CCGGTGGCAGTTCAGTCCCTTATTCCTCGAGGAATAAGGGACTGAACTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000391.3-1509s21c1
Sequence:CCGGGGATCCTATCCTTGATCAATGCTCGAGCATTGATCAAGGATAGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000391.3-2059s21c1
Sequence:CCGGACAGACTCTGTGCACTATTTCCTCGAGGAAATAGTGCACAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000391.x-270s1c1
Sequence:CCGGACCCTAGAGAATGTGGCTGATCTCGAGATCAGCCACATTCTCTAGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000391.x-792s1c1
Sequence:CCGGGCATCAGTAGCCCGTGTGGTTCTCGAGAACCACACGGGCTACTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-3179s1c1
Sequence:CCGGCCTCGTCTGTTAAGTGTGAATCTCGAGATTCACACTTAACAGACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-1000s1c1
Sequence:CCGGGCTATGGAGATGATGAGGACTCTCGAGAGTCCTCATCATCTCCATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000391.x-633s1c1
Sequence:CCGGCCCTCTGTGATCCGTAAGCGACTCGAGTCGCTTACGGATCACAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009906
TPP1 MISSION shRNA Bacterial Glycerol Stock
tripeptidyl peptidase I
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1475s1c1
Sequence:CCGGCCTTGATAAATGAGCACAGAACTCGAGTTCTGTGCTCATTTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1683s1c1
Sequence:CCGGCCTATTGAAGACCCTGCTCAACTCGAGTTGAGCAGGGTCTTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1217s1c1
Sequence:CCGGCAGATGAAGTAGTTGACTATACTCGAGTATAGTCAACTACTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-427s1c1
Sequence:CCGGGCTGAGTTTCATCGCTATGTACTCGAGTACATAGCGATGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-454s1c1
Sequence:CCGGCCTACAAAGACCCATGTTATACTCGAGTATAACATGGGTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009906
TPP1 MISSION shRNA shRNA Plasmid DNA
tripeptidyl peptidase I
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1475s1c1
Sequence:CCGGCCTTGATAAATGAGCACAGAACTCGAGTTCTGTGCTCATTTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1683s1c1
Sequence:CCGGCCTATTGAAGACCCTGCTCAACTCGAGTTGAGCAGGGTCTTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1217s1c1
Sequence:CCGGCAGATGAAGTAGTTGACTATACTCGAGTATAGTCAACTACTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-427s1c1
Sequence:CCGGGCTGAGTTTCATCGCTATGTACTCGAGTACATAGCGATGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-454s1c1
Sequence:CCGGCCTACAAAGACCCATGTTATACTCGAGTATAACATGGGTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009906
TPP1 MISSION shRNA Lentiviral Transduction Particles
tripeptidyl peptidase I
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1475s1c1
Sequence:CCGGCCTTGATAAATGAGCACAGAACTCGAGTTCTGTGCTCATTTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1683s1c1
Sequence:CCGGCCTATTGAAGACCCTGCTCAACTCGAGTTGAGCAGGGTCTTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-1217s1c1
Sequence:CCGGCAGATGAAGTAGTTGACTATACTCGAGTATAGTCAACTACTTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-427s1c1
Sequence:CCGGGCTGAGTTTCATCGCTATGTACTCGAGTACATAGCGATGAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009906.2-454s1c1
Sequence:CCGGCCTACAAAGACCCATGTTATACTCGAGTATAACATGGGTCTTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks