EMAIL THIS PAGE TO A FRIEND

TPP2

tripeptidyl peptidase II

Synonyms: TPP-2
UniProtKB ID: P29144, Q5VZU8
Gene ID:
Human(7174) Summary: This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
Mouse(22019) tripeptidyl peptidase II
Rat(81815) tripeptidyl peptidase II
cow(526052) tripeptidyl peptidase II
sheep(101113507) tripeptidyl peptidase II
Domestic Rabbit(100359134) tripeptidyl peptidase II
naked mole-rat(101700345) tripeptidyl peptidase II
domestic guinea pig(100720822) tripeptidyl peptidase II
Thale Cress(827833) tripeptidyl peptidase II
Horse(100050973) tripeptidyl peptidase II
domestic cat(101082370) tripeptidyl peptidase II
dog(100682942) tripeptidyl peptidase II
chicken(428020) tripeptidyl peptidase II
Zebrafish(100331669) tripeptidyl peptidase II
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A9502 Ala-Ala human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009418 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009418 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009418 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003291 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003291 Rosetta Predictions human pricing
NM_031137 Rosetta Predictions rat pricing
NM_009418 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079389 predicted 1138
2 SASI_Hs02_00335368 predicted 2041
3 SASI_Hs01_00079392 predicted 2197
4 SASI_Hs02_00335369 predicted 830
5 SASI_Hs01_00079393 predicted 2784
6 SASI_Hs02_00335370 predicted 3814
7 SASI_Hs02_00335371 predicted 406
8 SASI_Hs01_00079396 predicted 3947
9 SASI_Hs01_00079397 predicted 1614
10 SASI_Hs01_00079398 predicted 464
11 SASI_Hs01_00079390 predicted 2977
12 SASI_Hs01_00079391 predicted 1143
13 SASI_Hs01_00079394 predicted 2824
14 SASI_Hs01_00079395 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068869 predicted 2522
2 SASI_Rn02_00264466 predicted 1756
3 SASI_Rn01_00068871 predicted 1134
4 SASI_Rn01_00068872 predicted 1933
5 SASI_Rn01_00068873 predicted 2695
6 SASI_Rn01_00068874 predicted 379
7 SASI_Rn01_00068876 predicted 1502
8 SASI_Rn02_00264467 predicted 3610
9 SASI_Rn02_00264468 predicted 1526
10 SASI_Rn02_00264469 predicted 583
11 SASI_Rn01_00068870 predicted 3820
12 SASI_Rn01_00068875 predicted 2709
13 SASI_Rn01_00068877 predicted 2261
14 SASI_Rn01_00068878 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009418 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176570 predicted 1009
2 SASI_Mm01_00176571 predicted 2592
3 SASI_Mm01_00176572 predicted 3837
4 SASI_Mm01_00176574 predicted 3680
5 SASI_Mm01_00176575 predicted 1597
6 SASI_Mm02_00316071 predicted 3092
7 SASI_Mm02_00316072 predicted 2622
8 SASI_Mm01_00176577 predicted 2527
9 SASI_Mm02_00316073 predicted 1577
10 SASI_Mm02_00316074 predicted 2327
11 SASI_Mm01_00176573 predicted 1211
12 SASI_Mm01_00176576 predicted 2764
13 SASI_Mm01_00176578 predicted 452
14 SASI_Mm01_00176579 predicted 2015
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009418
VALIDATED
TPP2 MISSION shRNA Bacterial Glycerol Stock
tripeptidyl peptidase II
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-3227s1c1
Sequence:CCGGGCTTGATTCTACTGACATTTACTCGAGTAAATGTCAGTAGAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-245s1c1
Sequence:CCGGGCAGGTTACAACTGATGGAAACTCGAGTTTCCATCAGTTGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-579s1c1
Sequence:CCGGGCCAATAAACTAATCAAGGAACTCGAGTTCCTTGATTAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-2522s1c1
Sequence:CCGGGCCAAATAATCGCCAGCTTTACTCGAGTAAAGCTGGCGATTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-3838s1c1
Sequence:CCGGCCATCATGTATCCTCCTGATTCTCGAGAATCAGGAGGATACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-734s21c1
Sequence:CCGGTTGAGTAAATGTGCCGTATTGCTCGAGCAATACGGCACATTTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009418.2-3976s21c1
Sequence:CCGGACCATTCAATACTGATCATTACTCGAGTAATGATCAGTATTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009418.2-2465s21c1
Sequence:CCGGCAAACGCTACGCCCAGTAAATCTCGAGATTTACTGGGCGTAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-3430s21c1
Sequence:CCGGGCCTGATGCAGCTACTATAAACTCGAGTTTATAGTAGCTGCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-1848s21c1
Sequence:CCGGTGAATCAGTGTCGGCACATAACTCGAGTTATGTGCCGACACTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009418
VALIDATED
TPP2 MISSION shRNA shRNA Plasmid DNA
tripeptidyl peptidase II
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-3227s1c1
Sequence:CCGGGCTTGATTCTACTGACATTTACTCGAGTAAATGTCAGTAGAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-245s1c1
Sequence:CCGGGCAGGTTACAACTGATGGAAACTCGAGTTTCCATCAGTTGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-579s1c1
Sequence:CCGGGCCAATAAACTAATCAAGGAACTCGAGTTCCTTGATTAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-2522s1c1
Sequence:CCGGGCCAAATAATCGCCAGCTTTACTCGAGTAAAGCTGGCGATTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-3838s1c1
Sequence:CCGGCCATCATGTATCCTCCTGATTCTCGAGAATCAGGAGGATACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-734s21c1
Sequence:CCGGTTGAGTAAATGTGCCGTATTGCTCGAGCAATACGGCACATTTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009418.2-3976s21c1
Sequence:CCGGACCATTCAATACTGATCATTACTCGAGTAATGATCAGTATTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009418.2-2465s21c1
Sequence:CCGGCAAACGCTACGCCCAGTAAATCTCGAGATTTACTGGGCGTAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-3430s21c1
Sequence:CCGGGCCTGATGCAGCTACTATAAACTCGAGTTTATAGTAGCTGCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-1848s21c1
Sequence:CCGGTGAATCAGTGTCGGCACATAACTCGAGTTATGTGCCGACACTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009418
VALIDATED
TPP2 MISSION shRNA Lentiviral Transduction Particles
tripeptidyl peptidase II
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-3227s1c1
Sequence:CCGGGCTTGATTCTACTGACATTTACTCGAGTAAATGTCAGTAGAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-245s1c1
Sequence:CCGGGCAGGTTACAACTGATGGAAACTCGAGTTTCCATCAGTTGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-579s1c1
Sequence:CCGGGCCAATAAACTAATCAAGGAACTCGAGTTCCTTGATTAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-2522s1c1
Sequence:CCGGGCCAAATAATCGCCAGCTTTACTCGAGTAAAGCTGGCGATTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009418.1-3838s1c1
Sequence:CCGGCCATCATGTATCCTCCTGATTCTCGAGAATCAGGAGGATACATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-734s21c1
Sequence:CCGGTTGAGTAAATGTGCCGTATTGCTCGAGCAATACGGCACATTTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009418.2-3976s21c1
Sequence:CCGGACCATTCAATACTGATCATTACTCGAGTAATGATCAGTATTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009418.2-2465s21c1
Sequence:CCGGCAAACGCTACGCCCAGTAAATCTCGAGATTTACTGGGCGTAGCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-3430s21c1
Sequence:CCGGGCCTGATGCAGCTACTATAAACTCGAGTTTATAGTAGCTGCATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009418.2-1848s21c1
Sequence:CCGGTGAATCAGTGTCGGCACATAACTCGAGTTATGTGCCGACACTGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003291
VALIDATED
TPP2 MISSION shRNA Bacterial Glycerol Stock
tripeptidyl peptidase II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-3128s1c1
Sequence:CCGGGCTGGATTCTAGTGACATTTACTCGAGTAAATGTCACTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003291.1-600s1c1
Sequence:CCGGCCTGTATATGACTGCTTGGTACTCGAGTACCAAGCAGTCATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003291.1-2542s1c1
Sequence:CCGGGCCCACTACTTTGTGAACTATCTCGAGATAGTTCACAAAGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-2727s1c1
Sequence:CCGGCGCCTTAAAGACCTTCCATTTCTCGAGAAATGGAAGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-1403s1c1
Sequence:CCGGCCTGATCCTTTCAGGTCTGAACTCGAGTTCAGACCTGAAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3822s21c1
Sequence:CCGGTCATGTATCCTCCCGATTATTCTCGAGAATAATCGGGAGGATACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003291.2-1634s21c1
Sequence:CCGGCTCGTTCAGAATACATCATTTCTCGAGAAATGATGTATTCTGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3208s21c1
Sequence:CCGGGCTGGATTCTAGTGACATTTACTCGAGTAAATGTCACTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-2807s21c1
Sequence:CCGGCGCCTTAAAGACCTTCCATTTCTCGAGAAATGGAAGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3953s21c1
Sequence:CCGGCACTATCCAGTACTGATTATTCTCGAGAATAATCAGTACTGGATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003291
VALIDATED
TPP2 MISSION shRNA shRNA Plasmid DNA
tripeptidyl peptidase II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-3128s1c1
Sequence:CCGGGCTGGATTCTAGTGACATTTACTCGAGTAAATGTCACTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003291.1-600s1c1
Sequence:CCGGCCTGTATATGACTGCTTGGTACTCGAGTACCAAGCAGTCATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003291.1-2542s1c1
Sequence:CCGGGCCCACTACTTTGTGAACTATCTCGAGATAGTTCACAAAGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-2727s1c1
Sequence:CCGGCGCCTTAAAGACCTTCCATTTCTCGAGAAATGGAAGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-1403s1c1
Sequence:CCGGCCTGATCCTTTCAGGTCTGAACTCGAGTTCAGACCTGAAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3822s21c1
Sequence:CCGGTCATGTATCCTCCCGATTATTCTCGAGAATAATCGGGAGGATACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003291.2-1634s21c1
Sequence:CCGGCTCGTTCAGAATACATCATTTCTCGAGAAATGATGTATTCTGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3208s21c1
Sequence:CCGGGCTGGATTCTAGTGACATTTACTCGAGTAAATGTCACTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-2807s21c1
Sequence:CCGGCGCCTTAAAGACCTTCCATTTCTCGAGAAATGGAAGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3953s21c1
Sequence:CCGGCACTATCCAGTACTGATTATTCTCGAGAATAATCAGTACTGGATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003291
VALIDATED
TPP2 MISSION shRNA Lentiviral Transduction Particles
tripeptidyl peptidase II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-3128s1c1
Sequence:CCGGGCTGGATTCTAGTGACATTTACTCGAGTAAATGTCACTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003291.1-600s1c1
Sequence:CCGGCCTGTATATGACTGCTTGGTACTCGAGTACCAAGCAGTCATATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003291.1-2542s1c1
Sequence:CCGGGCCCACTACTTTGTGAACTATCTCGAGATAGTTCACAAAGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-2727s1c1
Sequence:CCGGCGCCTTAAAGACCTTCCATTTCTCGAGAAATGGAAGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003291.1-1403s1c1
Sequence:CCGGCCTGATCCTTTCAGGTCTGAACTCGAGTTCAGACCTGAAAGGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3822s21c1
Sequence:CCGGTCATGTATCCTCCCGATTATTCTCGAGAATAATCGGGAGGATACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003291.2-1634s21c1
Sequence:CCGGCTCGTTCAGAATACATCATTTCTCGAGAAATGATGTATTCTGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3208s21c1
Sequence:CCGGGCTGGATTCTAGTGACATTTACTCGAGTAAATGTCACTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-2807s21c1
Sequence:CCGGCGCCTTAAAGACCTTCCATTTCTCGAGAAATGGAAGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303666    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003291.2-3953s21c1
Sequence:CCGGCACTATCCAGTACTGATTATTCTCGAGAATAATCAGTACTGGATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks