EMAIL THIS PAGE TO A FRIEND

TPPP2

tubulin polymerization-promoting protein family member 2

Synonyms: C14orf8 P18 p25beta
UniProtKB ID: P59282, Q2VYF3
Gene ID:
Mouse(219038) tubulin polymerization-promoting protein family member 2
Rat(498497) tubulin polymerization-promoting protein family member 2
cow(507212) tubulin polymerization-promoting protein family member 2
sheep(101111551) tubulin polymerization-promoting protein family member 2
naked mole-rat(101723087) tubulin polymerization-promoting protein family member 2
domestic guinea pig(100720361) tubulin polymerization-promoting protein family member 2
chicken(427270) tubulin polymerization-promoting protein family member 2
dog(475397) tubulin polymerization-promoting protein family member 2
domestic cat(101083942) tubulin polymerization-promoting protein family member 2
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA004120 Anti-TPPP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173846 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001128634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001128634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001128634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145051 MISSION® esiRNA esiRNA human TPPP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173846 Rosetta Predictions human pricing
NM_001109100 Rosetta Predictions rat pricing
NM_001128634 Rosetta Predictions mouse pricing
XM_127723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228393 predicted 259
2 SASI_Hs01_00228394 predicted 425
3 SASI_Hs01_00228395 predicted 257
4 SASI_Hs01_00228396 predicted 420
5 SASI_Hs01_00228397 predicted 329
6 SASI_Hs01_00228398 predicted 250
7 SASI_Hs01_00228399 predicted 263
8 SASI_Hs01_00228400 predicted 307
9 SASI_Hs01_00228401 predicted 263
10 SASI_Hs02_00368719 predicted 440
11 SASI_Hs01_00228392 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245130 predicted 307
2 SASI_Rn02_00245131 predicted 353
3 SASI_Rn02_00245132 predicted 296
4 SASI_Rn02_00245133 predicted 212
5 SASI_Rn02_00245134 predicted 350
6 SASI_Rn02_00245135 predicted 252
7 SASI_Rn02_00245136 predicted 334
8 SASI_Rn02_00245137 predicted 251
9 SASI_Rn02_00245138 predicted 323
10 SASI_Rn02_00245139 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310758 predicted 335
2 SASI_Mm02_00310759 predicted 215
3 SASI_Mm02_00310760 predicted 376
4 SASI_Mm02_00310761 predicted 280
5 SASI_Mm02_00310762 predicted 240
6 SASI_Mm02_00310763 predicted 356
7 SASI_Mm02_00310764 predicted 205
8 SASI_Mm02_00310765 predicted 276
9 SASI_Mm02_00310766 predicted 219
10 SASI_Mm02_00310767 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226939 predicted 456
2 SASI_Mm01_00226940 predicted 406
3 SASI_Mm01_00226941 predicted 459
4 SASI_Mm01_00226942 predicted 455
5 SASI_Mm01_00226943 predicted 457
6 SASI_Mm01_00226944 predicted 402
7 SASI_Mm01_00226945 predicted 457
8 SASI_Mm01_00226946 predicted 401
9 SASI_Mm01_00226947 predicted 473
10 SASI_Mm01_00226948 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173846
TPPP2 MISSION shRNA Bacterial Glycerol Stock
tubulin polymerization-promoting protein family member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-347s1c1
Sequence:CCGGCCTGGAGAACATTTATGGACTCTCGAGAGTCCATAAATGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-268s1c1
Sequence:CCGGCCATCACGTTTCAACAGTTCACTCGAGTGAACTGTTGAAACGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-569s1c1
Sequence:CCGGCTACGATAAGAAGACCAAGTACTCGAGTACTTGGTCTTCTTATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-118s1c1
Sequence:CCGGCGTTTGGAGAATCATCAAGCACTCGAGTGCTTGATGATTCTCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-339s1c1
Sequence:CCGGGATGAAGTCCTGGAGAACATTCTCGAGAATGTTCTCCAGGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173846.4-507s21c1
Sequence:CCGGGGCGCTACTAAAGCAACAACACTCGAGTGTTGTTGCTTTAGTAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173846.4-647s21c1
Sequence:CCGGAGGCTATGTGAGTGGTTACAACTCGAGTTGTAACCACTCACATAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173846
TPPP2 MISSION shRNA shRNA Plasmid DNA
tubulin polymerization-promoting protein family member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-347s1c1
Sequence:CCGGCCTGGAGAACATTTATGGACTCTCGAGAGTCCATAAATGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-268s1c1
Sequence:CCGGCCATCACGTTTCAACAGTTCACTCGAGTGAACTGTTGAAACGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-569s1c1
Sequence:CCGGCTACGATAAGAAGACCAAGTACTCGAGTACTTGGTCTTCTTATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-118s1c1
Sequence:CCGGCGTTTGGAGAATCATCAAGCACTCGAGTGCTTGATGATTCTCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-339s1c1
Sequence:CCGGGATGAAGTCCTGGAGAACATTCTCGAGAATGTTCTCCAGGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173846.4-507s21c1
Sequence:CCGGGGCGCTACTAAAGCAACAACACTCGAGTGTTGTTGCTTTAGTAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173846.4-647s21c1
Sequence:CCGGAGGCTATGTGAGTGGTTACAACTCGAGTTGTAACCACTCACATAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173846
TPPP2 MISSION shRNA Lentiviral Transduction Particles
tubulin polymerization-promoting protein family member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168223    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-347s1c1
Sequence:CCGGCCTGGAGAACATTTATGGACTCTCGAGAGTCCATAAATGTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168085    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-268s1c1
Sequence:CCGGCCATCACGTTTCAACAGTTCACTCGAGTGAACTGTTGAAACGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-569s1c1
Sequence:CCGGCTACGATAAGAAGACCAAGTACTCGAGTACTTGGTCTTCTTATCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-118s1c1
Sequence:CCGGCGTTTGGAGAATCATCAAGCACTCGAGTGCTTGATGATTCTCCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168583    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173846.3-339s1c1
Sequence:CCGGGATGAAGTCCTGGAGAACATTCTCGAGAATGTTCTCCAGGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173846.4-507s21c1
Sequence:CCGGGGCGCTACTAAAGCAACAACACTCGAGTGTTGTTGCTTTAGTAGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173846.4-647s21c1
Sequence:CCGGAGGCTATGTGAGTGGTTACAACTCGAGTTGTAACCACTCACATAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128634
TPPP2 MISSION shRNA Bacterial Glycerol Stock
tubulin polymerization-promoting protein family member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-53s21c1
Sequence:CCGGTCCATCGATTCGCTGTCTTTGCTCGAGCAAAGACAGCGAATCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-209s21c1
Sequence:CCGGATGCCAGAACCATCAACTTTCCTCGAGGAAAGTTGATGGTTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-339s21c1
Sequence:CCGGCACCACCGGTGTCACTAAATCCTCGAGGATTTAGTGACACCGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128634.1-548s21c1
Sequence:CCGGCCATCTTTGCCCGCTAGTTTCCTCGAGGAAACTAGCGGGCAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-412s21c1
Sequence:CCGGACTCACAAGGAGCGCTTTGATCTCGAGATCAAAGCGCTCCTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128634
TPPP2 MISSION shRNA shRNA Plasmid DNA
tubulin polymerization-promoting protein family member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-53s21c1
Sequence:CCGGTCCATCGATTCGCTGTCTTTGCTCGAGCAAAGACAGCGAATCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-209s21c1
Sequence:CCGGATGCCAGAACCATCAACTTTCCTCGAGGAAAGTTGATGGTTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-339s21c1
Sequence:CCGGCACCACCGGTGTCACTAAATCCTCGAGGATTTAGTGACACCGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128634.1-548s21c1
Sequence:CCGGCCATCTTTGCCCGCTAGTTTCCTCGAGGAAACTAGCGGGCAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-412s21c1
Sequence:CCGGACTCACAAGGAGCGCTTTGATCTCGAGATCAAAGCGCTCCTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128634
TPPP2 MISSION shRNA Lentiviral Transduction Particles
tubulin polymerization-promoting protein family member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-53s21c1
Sequence:CCGGTCCATCGATTCGCTGTCTTTGCTCGAGCAAAGACAGCGAATCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-209s21c1
Sequence:CCGGATGCCAGAACCATCAACTTTCCTCGAGGAAAGTTGATGGTTCTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-339s21c1
Sequence:CCGGCACCACCGGTGTCACTAAATCCTCGAGGATTTAGTGACACCGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128634.1-548s21c1
Sequence:CCGGCCATCTTTGCCCGCTAGTTTCCTCGAGGAAACTAGCGGGCAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128634.1-412s21c1
Sequence:CCGGACTCACAAGGAGCGCTTTGATCTCGAGATCAAAGCGCTCCTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks