EMAIL THIS PAGE TO A FRIEND

TPPP3

tubulin polymerization-promoting protein family member 3

Synonyms: p20 p25gamma
UniProtKB ID: Q9BW30, Q49AH9, Q9Y326, Q9Y6H0
Gene ID:
Mouse(67971) tubulin polymerization-promoting protein family member 3
Rat(291966) tubulin polymerization-promoting protein family member 3
Zebrafish(393825) tubulin polymerization-promoting protein family member 3
chicken(415669) tubulin polymerization-promoting protein family member 3
domestic cat(101100103) tubulin polymerization-promoting protein family member 3
dog(479687) tubulin polymerization-promoting protein family member 3
domestic guinea pig(100733704) tubulin polymerization-promoting protein family member 3
naked mole-rat(101713426) tubulin polymerization-promoting protein family member 3
cow(614988) tubulin polymerization-promoting protein family member 3
sheep(101113519) tubulin polymerization-promoting protein family member 3
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015964 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015964 Rosetta Predictions human pricing
NM_016140 Rosetta Predictions human pricing
NM_001009639 Rosetta Predictions rat pricing
NM_026481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201267 predicted 646
2 SASI_Hs01_00201268 predicted 458
3 SASI_Hs01_00201269 predicted 468
4 SASI_Hs01_00201270 predicted 611
5 SASI_Hs01_00201271 predicted 467
6 SASI_Hs01_00201272 predicted 524
7 SASI_Hs01_00201274 predicted 641
8 SASI_Hs01_00201275 predicted 552
9 SASI_Hs01_00201276 predicted 620
10 SASI_Hs02_00348631 predicted 505
11 SASI_Hs01_00201273 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111518 predicted 731
2 SASI_Hs01_00111519 predicted 552
3 SASI_Hs01_00111520 predicted 555
4 SASI_Hs01_00111521 predicted 703
5 SASI_Hs01_00111522 predicted 561
6 SASI_Hs01_00111523 predicted 619
7 SASI_Hs01_00111525 predicted 737
8 SASI_Hs01_00111526 predicted 646
9 SASI_Hs01_00111527 predicted 705
10 SASI_Hs02_00348934 predicted 596
11 SASI_Hs01_00111524 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120903 predicted 516
2 SASI_Rn01_00120905 predicted 299
3 SASI_Rn01_00120906 predicted 372
4 SASI_Rn02_00199658 predicted 266
5 SASI_Rn01_00120907 predicted 563
6 SASI_Rn01_00120909 predicted 574
7 SASI_Rn01_00120910 predicted 374
8 SASI_Rn01_00120911 predicted 418
9 SASI_Rn01_00120912 predicted 457
10 SASI_Rn02_00199659 predicted 220
11 SASI_Rn01_00120904 predicted 606
12 SASI_Rn01_00120908 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074522 predicted 267
2 SASI_Mm01_00074523 predicted 294
3 SASI_Mm01_00074524 predicted 426
4 SASI_Mm01_00074525 predicted 370
5 SASI_Mm01_00074526 predicted 608
6 SASI_Mm02_00330352 predicted 411
7 SASI_Mm01_00074528 predicted 515
8 SASI_Mm01_00074529 predicted 296
9 SASI_Mm01_00074530 predicted 556
10 SASI_Mm01_00074531 predicted 211
11 SASI_Mm01_00074527 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026481
TPPP3 MISSION shRNA Bacterial Glycerol Stock
tubulin polymerization-promoting protein family member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026481.2-833s21c1
Sequence:CCGGCTGGGAGTCAGTGCCTATATCCTCGAGGATATAGGCACTGACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-303s21c1
Sequence:CCGGCTGCTAGAGTAATCAACTATGCTCGAGCATAGTTGATTACTCTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-480s21c1
Sequence:CCGGTGACGGACACCAGTAAGTATACTCGAGTATACTTACTGGTGTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-437s21c1
Sequence:CCGGATTGGCGTCACCAAAGCTAAACTCGAGTTTAGCTTTGGTGACGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-341s21c1
Sequence:CCGGCTGGAAGAGCTGGCAACTAAGCTCGAGCTTAGTTGCCAGCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026481
TPPP3 MISSION shRNA shRNA Plasmid DNA
tubulin polymerization-promoting protein family member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026481.2-833s21c1
Sequence:CCGGCTGGGAGTCAGTGCCTATATCCTCGAGGATATAGGCACTGACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-303s21c1
Sequence:CCGGCTGCTAGAGTAATCAACTATGCTCGAGCATAGTTGATTACTCTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-480s21c1
Sequence:CCGGTGACGGACACCAGTAAGTATACTCGAGTATACTTACTGGTGTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-437s21c1
Sequence:CCGGATTGGCGTCACCAAAGCTAAACTCGAGTTTAGCTTTGGTGACGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-341s21c1
Sequence:CCGGCTGGAAGAGCTGGCAACTAAGCTCGAGCTTAGTTGCCAGCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026481
TPPP3 MISSION shRNA Lentiviral Transduction Particles
tubulin polymerization-promoting protein family member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026481.2-833s21c1
Sequence:CCGGCTGGGAGTCAGTGCCTATATCCTCGAGGATATAGGCACTGACTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-303s21c1
Sequence:CCGGCTGCTAGAGTAATCAACTATGCTCGAGCATAGTTGATTACTCTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-480s21c1
Sequence:CCGGTGACGGACACCAGTAAGTATACTCGAGTATACTTACTGGTGTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-437s21c1
Sequence:CCGGATTGGCGTCACCAAAGCTAAACTCGAGTTTAGCTTTGGTGACGCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026481.2-341s21c1
Sequence:CCGGCTGGAAGAGCTGGCAACTAAGCTCGAGCTTAGTTGCCAGCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015964
TPPP3 MISSION shRNA Bacterial Glycerol Stock
tubulin polymerization-promoting protein family member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-624s21c1
Sequence:CCGGACGTGAGCGCCTACAAGAATGCTCGAGCATTCTTGTAGGCGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-177s21c1
Sequence:CCGGAGGAGAGCTTCCGCAAGTTTGCTCGAGCAAACTTGCGGAAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-342s21c1
Sequence:CCGGCTGCTCGGGTCATCAACTATGCTCGAGCATAGTTGATGACCCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-470s21c1
Sequence:CCGGGCCAATGTGGGCGTCACTAAACTCGAGTTTAGTGACGCCCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015964.2-868s21c1
Sequence:CCGGCTCTTCCTGCTCCAACTTCTGCTCGAGCAGAAGTTGGAGCAGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-163s1c1
Sequence:CCGGGCAAGAGATGAATGGCAAGAACTCGAGTTCTTGCCATTCATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-250s1c1
Sequence:CCGGCATCGTCTTCTCCAAAGTCAACTCGAGTTGACTTTGGAGAAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-454s1c1
Sequence:CCGGGCTGACGGACACCAGCAGATACTCGAGTATCTGCTGGTGTCCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015964
TPPP3 MISSION shRNA shRNA Plasmid DNA
tubulin polymerization-promoting protein family member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-624s21c1
Sequence:CCGGACGTGAGCGCCTACAAGAATGCTCGAGCATTCTTGTAGGCGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-177s21c1
Sequence:CCGGAGGAGAGCTTCCGCAAGTTTGCTCGAGCAAACTTGCGGAAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-342s21c1
Sequence:CCGGCTGCTCGGGTCATCAACTATGCTCGAGCATAGTTGATGACCCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-470s21c1
Sequence:CCGGGCCAATGTGGGCGTCACTAAACTCGAGTTTAGTGACGCCCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015964.2-868s21c1
Sequence:CCGGCTCTTCCTGCTCCAACTTCTGCTCGAGCAGAAGTTGGAGCAGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-163s1c1
Sequence:CCGGGCAAGAGATGAATGGCAAGAACTCGAGTTCTTGCCATTCATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-250s1c1
Sequence:CCGGCATCGTCTTCTCCAAAGTCAACTCGAGTTGACTTTGGAGAAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-454s1c1
Sequence:CCGGGCTGACGGACACCAGCAGATACTCGAGTATCTGCTGGTGTCCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015964
TPPP3 MISSION shRNA Lentiviral Transduction Particles
tubulin polymerization-promoting protein family member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-624s21c1
Sequence:CCGGACGTGAGCGCCTACAAGAATGCTCGAGCATTCTTGTAGGCGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-177s21c1
Sequence:CCGGAGGAGAGCTTCCGCAAGTTTGCTCGAGCAAACTTGCGGAAGCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-342s21c1
Sequence:CCGGCTGCTCGGGTCATCAACTATGCTCGAGCATAGTTGATGACCCGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015964.2-470s21c1
Sequence:CCGGGCCAATGTGGGCGTCACTAAACTCGAGTTTAGTGACGCCCACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015964.2-868s21c1
Sequence:CCGGCTCTTCCTGCTCCAACTTCTGCTCGAGCAGAAGTTGGAGCAGGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-163s1c1
Sequence:CCGGGCAAGAGATGAATGGCAAGAACTCGAGTTCTTGCCATTCATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-250s1c1
Sequence:CCGGCATCGTCTTCTCCAAAGTCAACTCGAGTTGACTTTGGAGAAGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015964.1-454s1c1
Sequence:CCGGGCTGACGGACACCAGCAGATACTCGAGTATCTGCTGGTGTCCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks