EMAIL THIS PAGE TO A FRIEND

TPPP

tubulin polymerization promoting protein

Synonyms: TPPP/p25 TPPP1 p24 p25 p25alpha
UniProtKB ID: O94811
Gene ID:
Mouse(72948) tubulin polymerization promoting protein
Rat(361466) tubulin polymerization promoting protein
chicken(420800) tubulin polymerization promoting protein
domestic cat(101096035) tubulin polymerization promoting protein
dog(488072) tubulin polymerization promoting protein
domestic guinea pig(100734397) tubulin polymerization promoting protein
naked mole-rat(101702292) tubulin polymerization promoting protein
cow(280968) tubulin polymerization promoting protein
sheep(101110090) tubulin polymerization promoting protein
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007030 Rosetta Predictions human pricing
NM_001108461 Rosetta Predictions rat pricing
NM_182839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168478 predicted 820
2 SASI_Hs01_00168479 predicted 712
3 SASI_Hs01_00168480 predicted 1027
4 SASI_Hs01_00168481 predicted 987
5 SASI_Hs01_00168482 predicted 718
6 SASI_Hs01_00168483 predicted 438
7 SASI_Hs01_00168484 predicted 393
8 SASI_Hs02_00342804 predicted 839
9 SASI_Hs01_00168485 predicted 347
10 SASI_Hs01_00168486 predicted 828
11 SASI_Hs01_00168487 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238869 predicted 783
2 SASI_Rn02_00238870 predicted 772
3 SASI_Rn02_00238871 predicted 560
4 SASI_Rn02_00238872 predicted 353
5 SASI_Rn02_00238873 predicted 441
6 SASI_Rn02_00238874 predicted 452
7 SASI_Rn02_00238875 predicted 667
8 SASI_Rn02_00238876 predicted 602
9 SASI_Rn02_00238877 predicted 275
10 SASI_Rn02_00238878 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190122 predicted 1072
2 SASI_Mm01_00190123 predicted 1077
3 SASI_Mm01_00190124 predicted 1089
4 SASI_Mm01_00190125 predicted 1104
5 SASI_Mm01_00190126 predicted 738
6 SASI_Mm01_00190127 predicted 230
7 SASI_Mm01_00190128 predicted 573
8 SASI_Mm01_00190129 predicted 926
9 SASI_Mm01_00190130 predicted 1157
10 SASI_Mm02_00349980 predicted 624
11 SASI_Mm01_00190121 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182839
TPPP MISSION shRNA Bacterial Glycerol Stock
tubulin polymerization promoting protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-482s21c1
Sequence:CCGGTCATCTCTGGCGTCACGAAAGCTCGAGCTTTCGTGACGCCAGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-326s21c1
Sequence:CCGGTTGTCTTCAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTGAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-631s21c1
Sequence:CCGGGGCTATGTGCCTGGTTACAAGCTCGAGCTTGTAACCAGGCACATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182839.1-3626s21c1
Sequence:CCGGTGGAGTGACAGAGTCATATTTCTCGAGAAATATGACTCTGTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-561s21c1
Sequence:CCGGCAAGGAGCGTTTCGACCAATCCTCGAGGATTGGTCGAAACGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182839.1-3500s1c1
Sequence:CCGGCCCAGGAAACAAAGGATACATCTCGAGATGTATCCTTTGTTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182839.1-318s1c1
Sequence:CCGGCGTGGACATTGTCTTCAGCAACTCGAGTTGCTGAAGACAATGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182839
TPPP MISSION shRNA shRNA Plasmid DNA
tubulin polymerization promoting protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-482s21c1
Sequence:CCGGTCATCTCTGGCGTCACGAAAGCTCGAGCTTTCGTGACGCCAGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-326s21c1
Sequence:CCGGTTGTCTTCAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTGAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-631s21c1
Sequence:CCGGGGCTATGTGCCTGGTTACAAGCTCGAGCTTGTAACCAGGCACATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182839.1-3626s21c1
Sequence:CCGGTGGAGTGACAGAGTCATATTTCTCGAGAAATATGACTCTGTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-561s21c1
Sequence:CCGGCAAGGAGCGTTTCGACCAATCCTCGAGGATTGGTCGAAACGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182839.1-3500s1c1
Sequence:CCGGCCCAGGAAACAAAGGATACATCTCGAGATGTATCCTTTGTTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182839.1-318s1c1
Sequence:CCGGCGTGGACATTGTCTTCAGCAACTCGAGTTGCTGAAGACAATGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182839
TPPP MISSION shRNA Lentiviral Transduction Particles
tubulin polymerization promoting protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-482s21c1
Sequence:CCGGTCATCTCTGGCGTCACGAAAGCTCGAGCTTTCGTGACGCCAGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-326s21c1
Sequence:CCGGTTGTCTTCAGCAAGATCAAAGCTCGAGCTTTGATCTTGCTGAAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-631s21c1
Sequence:CCGGGGCTATGTGCCTGGTTACAAGCTCGAGCTTGTAACCAGGCACATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182839.1-3626s21c1
Sequence:CCGGTGGAGTGACAGAGTCATATTTCTCGAGAAATATGACTCTGTCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182839.1-561s21c1
Sequence:CCGGCAAGGAGCGTTTCGACCAATCCTCGAGGATTGGTCGAAACGCTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182839.1-3500s1c1
Sequence:CCGGCCCAGGAAACAAAGGATACATCTCGAGATGTATCCTTTGTTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182839.1-318s1c1
Sequence:CCGGCGTGGACATTGTCTTCAGCAACTCGAGTTGCTGAAGACAATGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007030
TPPP MISSION shRNA Bacterial Glycerol Stock
tubulin polymerization promoting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-411s1c1
Sequence:CCGGGCGATTCAAAGACAAGAGCAGCTCGAGCTGCTCTTGTCTTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162353    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4747s1c1
Sequence:CCGGCCTAACAATTAGCGTTACCAACTCGAGTTGGTAACGCTAATTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4161s1c1
Sequence:CCGGCCTCAGTCAGTTTCTGAATATCTCGAGATATTCAGAAACTGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-753s1c1
Sequence:CCGGGCACTTCATTACATTCCTGTACTCGAGTACAGGAATGTAATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-405s1c1
Sequence:CCGGCAAGAAGCGATTCAAAGACAACTCGAGTTGTCTTTGAATCGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-1424s1c1
Sequence:CCGGGCTTTGCTTTCCTGAGAAGATCTCGAGATCTTCTCAGGAAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-335s1c1
Sequence:CCGGGCAAGATCAAAGGGAAGTCTTCTCGAGAAGACTTCCCTTTGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-360s1c1
Sequence:CCGGGACCATCACCTTTGAGCAGTTCTCGAGAACTGCTCAAAGGTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4735s1c1
Sequence:CCGGCCAGGTAGTGTTCCTAACAATCTCGAGATTGTTAGGAACACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-2509s1c1
Sequence:CCGGGCGTGTGAAAGGCAGAACTAACTCGAGTTAGTTCTGCCTTTCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007030
TPPP MISSION shRNA shRNA Plasmid DNA
tubulin polymerization promoting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-411s1c1
Sequence:CCGGGCGATTCAAAGACAAGAGCAGCTCGAGCTGCTCTTGTCTTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162353    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4747s1c1
Sequence:CCGGCCTAACAATTAGCGTTACCAACTCGAGTTGGTAACGCTAATTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4161s1c1
Sequence:CCGGCCTCAGTCAGTTTCTGAATATCTCGAGATATTCAGAAACTGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-753s1c1
Sequence:CCGGGCACTTCATTACATTCCTGTACTCGAGTACAGGAATGTAATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-405s1c1
Sequence:CCGGCAAGAAGCGATTCAAAGACAACTCGAGTTGTCTTTGAATCGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-1424s1c1
Sequence:CCGGGCTTTGCTTTCCTGAGAAGATCTCGAGATCTTCTCAGGAAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-335s1c1
Sequence:CCGGGCAAGATCAAAGGGAAGTCTTCTCGAGAAGACTTCCCTTTGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-360s1c1
Sequence:CCGGGACCATCACCTTTGAGCAGTTCTCGAGAACTGCTCAAAGGTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4735s1c1
Sequence:CCGGCCAGGTAGTGTTCCTAACAATCTCGAGATTGTTAGGAACACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-2509s1c1
Sequence:CCGGGCGTGTGAAAGGCAGAACTAACTCGAGTTAGTTCTGCCTTTCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007030
TPPP MISSION shRNA Lentiviral Transduction Particles
tubulin polymerization promoting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-411s1c1
Sequence:CCGGGCGATTCAAAGACAAGAGCAGCTCGAGCTGCTCTTGTCTTTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162353    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4747s1c1
Sequence:CCGGCCTAACAATTAGCGTTACCAACTCGAGTTGGTAACGCTAATTGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4161s1c1
Sequence:CCGGCCTCAGTCAGTTTCTGAATATCTCGAGATATTCAGAAACTGACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-753s1c1
Sequence:CCGGGCACTTCATTACATTCCTGTACTCGAGTACAGGAATGTAATGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-405s1c1
Sequence:CCGGCAAGAAGCGATTCAAAGACAACTCGAGTTGTCTTTGAATCGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163799    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-1424s1c1
Sequence:CCGGGCTTTGCTTTCCTGAGAAGATCTCGAGATCTTCTCAGGAAAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-335s1c1
Sequence:CCGGGCAAGATCAAAGGGAAGTCTTCTCGAGAAGACTTCCCTTTGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007030.1-360s1c1
Sequence:CCGGGACCATCACCTTTGAGCAGTTCTCGAGAACTGCTCAAAGGTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164184    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-4735s1c1
Sequence:CCGGCCAGGTAGTGTTCCTAACAATCTCGAGATTGTTAGGAACACTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165449    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007030.1-2509s1c1
Sequence:CCGGGCGTGTGAAAGGCAGAACTAACTCGAGTTAGTTCTGCCTTTCACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks