EMAIL THIS PAGE TO A FRIEND

TPR

translocated promoter region, nuclear basket protein

UniProtKB ID: P12270, Q15655, Q5SWY0, Q99968
Gene ID:
Human(7175) Summary: This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Mouse(108989) translocated promoter region
Rat(304862) translocated promoter region, nuclear basket protein
cow(507869) translocated promoter region (to activated MET oncogene)
sheep(101109818) translocated promoter region, nuclear basket protein
naked mole-rat(101706333) translocated promoter region, nuclear basket protein
domestic guinea pig(100718971) translocated promoter region, nuclear basket protein
chicken(424457) translocated promoter region, nuclear basket protein
domestic cat(101082873) translocated promoter region, nuclear basket protein
dog(480045) translocated promoter region, nuclear basket protein
Horse(100049850) translocated promoter region, nuclear basket protein
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003292 Rosetta Predictions human pricing
NM_001107185 Rosetta Predictions rat pricing
NM_133780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026464 predicted 3179
2 SASI_Hs02_00335372 predicted 3136
3 SASI_Hs02_00335373 predicted 3955
4 SASI_Hs01_00026465 predicted 4143
5 SASI_Hs01_00026466 predicted 2612
6 SASI_Hs01_00026468 predicted 4303
7 SASI_Hs01_00026469 predicted 1831
8 SASI_Hs01_00026471 predicted 3252
9 SASI_Hs02_00335374 predicted 3931
10 SASI_Hs01_00026472 predicted 4990
11 SASI_Hs01_00026467 predicted 6772
12 SASI_Hs01_00026470 predicted 5397
13 SASI_Hs01_00026473 predicted 5535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226345 predicted 1629
2 SASI_Rn02_00226346 predicted 4468
3 SASI_Rn02_00226347 predicted 4486
4 SASI_Rn02_00226348 predicted 2567
5 SASI_Rn02_00226349 predicted 1833
6 SASI_Rn02_00226350 predicted 3169
7 SASI_Rn02_00226351 predicted 6642
8 SASI_Rn02_00226352 predicted 4101
9 SASI_Rn02_00226353 predicted 735
10 SASI_Rn02_00226354 predicted 7231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338803 predicted 4475
2 SASI_Mm01_00084101 predicted 2887
3 SASI_Mm01_00084102 predicted 7230
4 SASI_Mm01_00084103 predicted 2772
5 SASI_Mm01_00084104 predicted 4460
6 SASI_Mm01_00084105 predicted 3389
7 SASI_Mm01_00084106 predicted 7024
8 SASI_Mm01_00084107 predicted 1844
9 SASI_Mm01_00084108 predicted 966
10 SASI_Mm01_00084110 predicted 5684
11 SASI_Mm01_00084109 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003292
VALIDATED
TPR MISSION shRNA Bacterial Glycerol Stock
translocated promoter region, nuclear basket protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-5565s1c1
Sequence:CCGGGCCTTCTATCTCTCAACCTATCTCGAGATAGGTTGAGAGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003292.1-5994s1c1
Sequence:CCGGCCAGGGAGATTATACACCTATCTCGAGATAGGTGTATAATCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-2778s1c1
Sequence:CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-4612s1c1
Sequence:CCGGCGTAGGTACAAGACTCAATATCTCGAGATATTGAGTCTTGTACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-1173s1c1
Sequence:CCGGCGCTGATGACTCAGAAGCAAACTCGAGTTTGCTTCTGAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-2126s21c1
Sequence:GTACCGGAGCGTGATATGTACCGTATTTCTCGAGAAATACGGTACATATCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-4612s21c1
Sequence:CCGGCGTAGGTACAAGACTCAATATCTCGAGATATTGAGTCTTGTACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-1173s21c1
Sequence:CCGGCGCTGATGACTCAGAAGCAAACTCGAGTTTGCTTCTGAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003292.2-2778s21c1
Sequence:CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003292.2-5565s21c1
Sequence:CCGGGCCTTCTATCTCTCAACCTATCTCGAGATAGGTTGAGAGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003292.2-7746s21c1
Sequence:CCGGTGTTGACTATTATGCTCAAAGCTCGAGCTTTGAGCATAATAGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003292
VALIDATED
TPR MISSION shRNA shRNA Plasmid DNA
translocated promoter region, nuclear basket protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-5565s1c1
Sequence:CCGGGCCTTCTATCTCTCAACCTATCTCGAGATAGGTTGAGAGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003292.1-5994s1c1
Sequence:CCGGCCAGGGAGATTATACACCTATCTCGAGATAGGTGTATAATCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-2778s1c1
Sequence:CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-4612s1c1
Sequence:CCGGCGTAGGTACAAGACTCAATATCTCGAGATATTGAGTCTTGTACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-1173s1c1
Sequence:CCGGCGCTGATGACTCAGAAGCAAACTCGAGTTTGCTTCTGAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-2126s21c1
Sequence:GTACCGGAGCGTGATATGTACCGTATTTCTCGAGAAATACGGTACATATCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-4612s21c1
Sequence:CCGGCGTAGGTACAAGACTCAATATCTCGAGATATTGAGTCTTGTACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-1173s21c1
Sequence:CCGGCGCTGATGACTCAGAAGCAAACTCGAGTTTGCTTCTGAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003292.2-2778s21c1
Sequence:CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003292.2-5565s21c1
Sequence:CCGGGCCTTCTATCTCTCAACCTATCTCGAGATAGGTTGAGAGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003292.2-7746s21c1
Sequence:CCGGTGTTGACTATTATGCTCAAAGCTCGAGCTTTGAGCATAATAGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003292
VALIDATED
TPR MISSION shRNA Lentiviral Transduction Particles
translocated promoter region, nuclear basket protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-5565s1c1
Sequence:CCGGGCCTTCTATCTCTCAACCTATCTCGAGATAGGTTGAGAGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003292.1-5994s1c1
Sequence:CCGGCCAGGGAGATTATACACCTATCTCGAGATAGGTGTATAATCTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-2778s1c1
Sequence:CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-4612s1c1
Sequence:CCGGCGTAGGTACAAGACTCAATATCTCGAGATATTGAGTCTTGTACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003292.1-1173s1c1
Sequence:CCGGCGCTGATGACTCAGAAGCAAACTCGAGTTTGCTTCTGAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-2126s21c1
Sequence:GTACCGGAGCGTGATATGTACCGTATTTCTCGAGAAATACGGTACATATCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-4612s21c1
Sequence:CCGGCGTAGGTACAAGACTCAATATCTCGAGATATTGAGTCTTGTACCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003292.2-1173s21c1
Sequence:CCGGCGCTGATGACTCAGAAGCAAACTCGAGTTTGCTTCTGAGTCATCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003292.2-2778s21c1
Sequence:CCGGGCGATCTGAAACAGAAACCAACTCGAGTTGGTTTCTGTTTCAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003292.2-5565s21c1
Sequence:CCGGGCCTTCTATCTCTCAACCTATCTCGAGATAGGTTGAGAGATAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304030    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003292.2-7746s21c1
Sequence:CCGGTGTTGACTATTATGCTCAAAGCTCGAGCTTTGAGCATAATAGTCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133780
VALIDATED
TPR MISSION shRNA Bacterial Glycerol Stock
translocated promoter region, nuclear basket protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133780.2-5651s1c1
Sequence:CCGGCCGCAGATTGAGCCTACAAATCTCGAGATTTGTAGGCTCAATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-1154s1c1
Sequence:CCGGGCTCACATAAAGCTCTCTAATCTCGAGATTAGAGAGCTTTATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-5201s1c1
Sequence:CCGGCCCACTAATAAGGCTCCAGAACTCGAGTTCTGGAGCCTTATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-2758s1c1
Sequence:CCGGGCTGACTAATCTACAGACAATCTCGAGATTGTCTGTAGATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-4628s1c1
Sequence:CCGGCGCAGGTACAAGACTCAGTTTCTCGAGAAACTGAGTCTTGTACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133780.2-7102s21c1
Sequence:CCGGGGCGGAGTCTGAAGGTATTAGCTCGAGCTAATACCTTCAGACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-3781s21c1
Sequence:CCGGCCGACTACTTCATGATCAAATCTCGAGATTTGATCATGAAGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-5991s21c1
Sequence:CCGGGAGTTACCCAGGGAGATTATACTCGAGTATAATCTCCCTGGGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133780.2-2142s21c1
Sequence:CCGGAGCGTGACATGTACCGAATTTCTCGAGAAATTCGGTACATGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-4323s21c1
Sequence:CCGGCACGGAACCAGCAACTAATAACTCGAGTTATTAGTTGCTGGTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133780
VALIDATED
TPR MISSION shRNA shRNA Plasmid DNA
translocated promoter region, nuclear basket protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133780.2-5651s1c1
Sequence:CCGGCCGCAGATTGAGCCTACAAATCTCGAGATTTGTAGGCTCAATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-1154s1c1
Sequence:CCGGGCTCACATAAAGCTCTCTAATCTCGAGATTAGAGAGCTTTATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-5201s1c1
Sequence:CCGGCCCACTAATAAGGCTCCAGAACTCGAGTTCTGGAGCCTTATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-2758s1c1
Sequence:CCGGGCTGACTAATCTACAGACAATCTCGAGATTGTCTGTAGATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-4628s1c1
Sequence:CCGGCGCAGGTACAAGACTCAGTTTCTCGAGAAACTGAGTCTTGTACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133780.2-7102s21c1
Sequence:CCGGGGCGGAGTCTGAAGGTATTAGCTCGAGCTAATACCTTCAGACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-3781s21c1
Sequence:CCGGCCGACTACTTCATGATCAAATCTCGAGATTTGATCATGAAGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-5991s21c1
Sequence:CCGGGAGTTACCCAGGGAGATTATACTCGAGTATAATCTCCCTGGGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133780.2-2142s21c1
Sequence:CCGGAGCGTGACATGTACCGAATTTCTCGAGAAATTCGGTACATGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-4323s21c1
Sequence:CCGGCACGGAACCAGCAACTAATAACTCGAGTTATTAGTTGCTGGTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133780
VALIDATED
TPR MISSION shRNA Lentiviral Transduction Particles
translocated promoter region, nuclear basket protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133780.2-5651s1c1
Sequence:CCGGCCGCAGATTGAGCCTACAAATCTCGAGATTTGTAGGCTCAATCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-1154s1c1
Sequence:CCGGGCTCACATAAAGCTCTCTAATCTCGAGATTAGAGAGCTTTATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-5201s1c1
Sequence:CCGGCCCACTAATAAGGCTCCAGAACTCGAGTTCTGGAGCCTTATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-2758s1c1
Sequence:CCGGGCTGACTAATCTACAGACAATCTCGAGATTGTCTGTAGATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133780.2-4628s1c1
Sequence:CCGGCGCAGGTACAAGACTCAGTTTCTCGAGAAACTGAGTCTTGTACCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133780.2-7102s21c1
Sequence:CCGGGGCGGAGTCTGAAGGTATTAGCTCGAGCTAATACCTTCAGACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-3781s21c1
Sequence:CCGGCCGACTACTTCATGATCAAATCTCGAGATTTGATCATGAAGTAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-5991s21c1
Sequence:CCGGGAGTTACCCAGGGAGATTATACTCGAGTATAATCTCCCTGGGTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133780.2-2142s21c1
Sequence:CCGGAGCGTGACATGTACCGAATTTCTCGAGAAATTCGGTACATGTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133780.2-4323s21c1
Sequence:CCGGCACGGAACCAGCAACTAATAACTCGAGTTATTAGTTGCTGGTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks