EMAIL THIS PAGE TO A FRIEND

TPRA1

transmembrane protein, adipocyte asscociated 1

Synonyms: GPR175 TMEM227 TPRA40
UniProtKB ID: Q86W33, A8MVB8, D3DNA9, Q8WZ24, Q96AJ6, Q9P2R4
Gene ID:
Mouse(24100) transmembrane protein, adipocyte asscociated 1
Rat(85494) transmembrane protein, adipocyte asscociated 1
Zebrafish(570573) transmembrane protein, adipocyte asscociated 1
chicken(416028) transmembrane protein, adipocyte asscociated 1
domestic cat(101090426) transmembrane protein, adipocyte asscociated 1
dog(484621) transmembrane protein, adipocyte asscociated 1
domestic guinea pig(100719642) transmembrane protein, adipocyte asscociated 1
naked mole-rat(101707036) transmembrane protein, adipocyte asscociated 1
cow(617772) transmembrane protein, adipocyte asscociated 1
sheep(101116354) transmembrane protein, adipocyte asscociated 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016372 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016372 Rosetta Predictions human pricing
NM_053534 Rosetta Predictions rat pricing
XM_579561 Rosetta Predictions rat pricing
NM_011906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104788 predicted 1185
2 SASI_Hs01_00104792 predicted 607
3 SASI_Hs01_00104793 predicted 1277
4 SASI_Hs01_00104796 predicted 1390
5 SASI_Hs01_00104797 predicted 1090
6 SASI_Hs02_00349361 predicted 1053
7 SASI_Hs02_00349362 predicted 1159
8 SASI_Hs02_00349363 predicted 1019
9 SASI_Hs01_00104789 predicted 528
10 SASI_Hs02_00349364 predicted 699
11 SASI_Hs01_00104790 predicted 823
12 SASI_Hs01_00104791 predicted 1634
13 SASI_Hs01_00104794 predicted 532
14 SASI_Hs01_00104795 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040559 predicted 341
2 SASI_Rn02_00266152 predicted 367
3 SASI_Rn01_00040560 predicted 432
4 SASI_Rn01_00040561 predicted 314
5 SASI_Rn01_00040562 predicted 736
6 SASI_Rn01_00040563 predicted 531
7 SASI_Rn01_00040564 predicted 611
8 SASI_Rn01_00040565 predicted 400
9 SASI_Rn01_00040566 predicted 395
10 SASI_Rn01_00040567 predicted 809
11 SASI_Rn01_00040568 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165807 predicted 461
2 SASI_Rn01_00165808 predicted 701
3 SASI_Rn01_00165809 predicted 340
4 SASI_Rn01_00165810 predicted 429
5 SASI_Rn01_00165811 predicted 536
6 SASI_Rn01_00165812 predicted 320
7 SASI_Rn01_00165813 predicted 255
8 SASI_Rn01_00165814 predicted 613
9 SASI_Rn01_00165815 predicted 591
10 SASI_Rn01_00165816 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200530 predicted 654
2 SASI_Mm01_00200531 predicted 467
3 SASI_Mm01_00200532 predicted 1408
4 SASI_Mm01_00200533 predicted 836
5 SASI_Mm02_00321727 predicted 1153
6 SASI_Mm02_00321728 predicted 567
7 SASI_Mm01_00200534 predicted 1024
8 SASI_Mm01_00200535 predicted 752
9 SASI_Mm01_00200536 predicted 808
10 SASI_Mm01_00200537 predicted 504
11 SASI_Mm01_00200538 predicted 377
12 SASI_Mm01_00200539 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016372
VALIDATED
TPRA1 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein, adipocyte asscociated 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-1157s21c1
Sequence:CCGGAGATCCTCTTCTCCTACAAATCTCGAGATTTGTAGGAGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-823s21c1
Sequence:CCGGCTCTCAGCTGAGGACTTTAATCTCGAGATTAAAGTCCTCAGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-965s21c1
Sequence:CCGGGGAGGAGCTTCTACGTGTATGCTCGAGCATACACGTAGAAGCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-615s21c1
Sequence:CCGGCGCTGCAACTGTTGCTGATAACTCGAGTTATCAGCAACAGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016372.1-1496s1c1
Sequence:CCGGAGGGACGTTCTGTGGGCAGTACTCGAGTACTGCCCACAGAACGTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-355s1c1
Sequence:CCGGCCAAACATCAGTGTGCCTCATCTCGAGATGAGGCACACTGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-835s1c1
Sequence:CCGGGACTTTAATATCTATGGCCATCTCGAGATGGCCATAGATATTAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-1325s1c1
Sequence:CCGGCCTACCTGGATGACATCGCTTCTCGAGAAGCGATGTCATCCAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016372.1-385s1c1
Sequence:CCGGCTGCTGCTCTACGAAGACATTCTCGAGAATGTCTTCGTAGAGCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016372
VALIDATED
TPRA1 MISSION shRNA shRNA Plasmid DNA
transmembrane protein, adipocyte asscociated 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-1157s21c1
Sequence:CCGGAGATCCTCTTCTCCTACAAATCTCGAGATTTGTAGGAGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-823s21c1
Sequence:CCGGCTCTCAGCTGAGGACTTTAATCTCGAGATTAAAGTCCTCAGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-965s21c1
Sequence:CCGGGGAGGAGCTTCTACGTGTATGCTCGAGCATACACGTAGAAGCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-615s21c1
Sequence:CCGGCGCTGCAACTGTTGCTGATAACTCGAGTTATCAGCAACAGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016372.1-1496s1c1
Sequence:CCGGAGGGACGTTCTGTGGGCAGTACTCGAGTACTGCCCACAGAACGTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-355s1c1
Sequence:CCGGCCAAACATCAGTGTGCCTCATCTCGAGATGAGGCACACTGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-835s1c1
Sequence:CCGGGACTTTAATATCTATGGCCATCTCGAGATGGCCATAGATATTAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-1325s1c1
Sequence:CCGGCCTACCTGGATGACATCGCTTCTCGAGAAGCGATGTCATCCAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016372.1-385s1c1
Sequence:CCGGCTGCTGCTCTACGAAGACATTCTCGAGAATGTCTTCGTAGAGCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016372
VALIDATED
TPRA1 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein, adipocyte asscociated 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-1157s21c1
Sequence:CCGGAGATCCTCTTCTCCTACAAATCTCGAGATTTGTAGGAGAAGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-823s21c1
Sequence:CCGGCTCTCAGCTGAGGACTTTAATCTCGAGATTAAAGTCCTCAGCTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-965s21c1
Sequence:CCGGGGAGGAGCTTCTACGTGTATGCTCGAGCATACACGTAGAAGCTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016372.2-615s21c1
Sequence:CCGGCGCTGCAACTGTTGCTGATAACTCGAGTTATCAGCAACAGTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016372.1-1496s1c1
Sequence:CCGGAGGGACGTTCTGTGGGCAGTACTCGAGTACTGCCCACAGAACGTCCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-355s1c1
Sequence:CCGGCCAAACATCAGTGTGCCTCATCTCGAGATGAGGCACACTGATGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-835s1c1
Sequence:CCGGGACTTTAATATCTATGGCCATCTCGAGATGGCCATAGATATTAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016372.1-1325s1c1
Sequence:CCGGCCTACCTGGATGACATCGCTTCTCGAGAAGCGATGTCATCCAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016372.1-385s1c1
Sequence:CCGGCTGCTGCTCTACGAAGACATTCTCGAGAATGTCTTCGTAGAGCAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011906
VALIDATED
TPRA1 MISSION shRNA Bacterial Glycerol Stock
transmembrane protein, adipocyte asscociated 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.2-1027s1c1
Sequence:CCGGGTCTACTCACTGGTGGTAATTCTCGAGAATTACCACCAGTGAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011906.2-1028s21c1
Sequence:CCGGTCTACTCACTGGTGGTAATTCCTCGAGGAATTACCACCAGTGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011906.2-1651s21c1
Sequence:CCGGTTTGCCTCCTGTGCTCTAGTGCTCGAGCACTAGAGCACAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011906.2-512s21c1
Sequence:CCGGTGCTGCTATATGAGGATATTGCTCGAGCAATATCCTCATATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011906.2-468s21c1
Sequence:CCGGACCGCCCACAGCATCCAATATCTCGAGATATTGGATGCTGTGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.1-377s1c1
Sequence:CCGGCATTCCCAATGTGCTCTTCTTCTCGAGAAGAAGAGCACATTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.1-1016s1c1
Sequence:CCGGCTTCCTGTACTTCAGCTTCTTCTCGAGAAGAAGCTGAAGTACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011906
VALIDATED
TPRA1 MISSION shRNA shRNA Plasmid DNA
transmembrane protein, adipocyte asscociated 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.2-1027s1c1
Sequence:CCGGGTCTACTCACTGGTGGTAATTCTCGAGAATTACCACCAGTGAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011906.2-1028s21c1
Sequence:CCGGTCTACTCACTGGTGGTAATTCCTCGAGGAATTACCACCAGTGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011906.2-1651s21c1
Sequence:CCGGTTTGCCTCCTGTGCTCTAGTGCTCGAGCACTAGAGCACAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011906.2-512s21c1
Sequence:CCGGTGCTGCTATATGAGGATATTGCTCGAGCAATATCCTCATATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011906.2-468s21c1
Sequence:CCGGACCGCCCACAGCATCCAATATCTCGAGATATTGGATGCTGTGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.1-377s1c1
Sequence:CCGGCATTCCCAATGTGCTCTTCTTCTCGAGAAGAAGAGCACATTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.1-1016s1c1
Sequence:CCGGCTTCCTGTACTTCAGCTTCTTCTCGAGAAGAAGCTGAAGTACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011906
VALIDATED
TPRA1 MISSION shRNA Lentiviral Transduction Particles
transmembrane protein, adipocyte asscociated 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.2-1027s1c1
Sequence:CCGGGTCTACTCACTGGTGGTAATTCTCGAGAATTACCACCAGTGAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011906.2-1028s21c1
Sequence:CCGGTCTACTCACTGGTGGTAATTCCTCGAGGAATTACCACCAGTGAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011906.2-1651s21c1
Sequence:CCGGTTTGCCTCCTGTGCTCTAGTGCTCGAGCACTAGAGCACAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011906.2-512s21c1
Sequence:CCGGTGCTGCTATATGAGGATATTGCTCGAGCAATATCCTCATATAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011906.2-468s21c1
Sequence:CCGGACCGCCCACAGCATCCAATATCTCGAGATATTGGATGCTGTGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.1-377s1c1
Sequence:CCGGCATTCCCAATGTGCTCTTCTTCTCGAGAAGAAGAGCACATTGGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011906.1-1016s1c1
Sequence:CCGGCTTCCTGTACTTCAGCTTCTTCTCGAGAAGAAGCTGAAGTACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks