EMAIL THIS PAGE TO A FRIEND

TPRG1

tumor protein p63 regulated 1

Synonyms: FAM79B
UniProtKB ID: Q6ZUI0
Gene ID:
Rat(360731) tumor protein p63 regulated 1
cow(615508) tumor protein p63 regulated 1
sheep(101109847) tumor protein p63 regulated 1
naked mole-rat(101711439) tumor protein p63 regulated 1
domestic guinea pig(100731876) tumor protein p63 regulated 1
Zebrafish(560596) tumor protein p63 regulated 1
domestic cat(101096005) tumor protein p63 regulated 1
dog(478672) tumor protein p63 regulated 1
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198485 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037691 MISSION® esiRNA esiRNA human TPRG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198485 Rosetta Predictions human pricing
NM_001108320 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372038 predicted 922
2 SASI_Hs01_00135369 predicted 779
3 SASI_Hs01_00135370 predicted 928
4 SASI_Hs01_00135371 predicted 1047
5 SASI_Hs01_00135373 predicted 435
6 SASI_Hs01_00135374 predicted 750
7 SASI_Hs02_00372039 predicted 774
8 SASI_Hs01_00135376 predicted 876
9 SASI_Hs01_00135377 predicted 742
10 SASI_Hs02_00372040 predicted 328
11 SASI_Hs01_00135372 predicted 425
12 SASI_Hs01_00135375 predicted 817
13 SASI_Hs01_00135378 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237499 predicted 821
2 SASI_Rn02_00237500 predicted 461
3 SASI_Rn02_00237501 predicted 705
4 SASI_Rn02_00237502 predicted 609
5 SASI_Rn02_00237503 predicted 651
6 SASI_Rn02_00237504 predicted 349
7 SASI_Rn02_00237505 predicted 699
8 SASI_Rn02_00237506 predicted 791
9 SASI_Rn02_00237507 predicted 394
10 SASI_Rn02_00237508 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198485
TPRG1 MISSION shRNA Bacterial Glycerol Stock
tumor protein p63 regulated 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198485.3-1356s21c1
Sequence:CCGGAGCCCTCTTATCCTGATTTATCTCGAGATAAATCAGGATAAGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198485.3-1389s21c1
Sequence:CCAGGTCTCACTGTCTCTAGTATTTCTCGAGAAATACTAGAGACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-465s1c1
Sequence:CCGGGACAAAGATAGACCACTGGAACTCGAGTTCCAGTGGTCTATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198485.1-3024s1c1
Sequence:CCGGCCAGTCTGTAACAATGGGATACTCGAGTATCCCATTGTTACAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198485.1-519s1c1
Sequence:CCGGCAAGACTCTCTTGATCTGCAACTCGAGTTGCAGATCAAGAGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-933s1c1
Sequence:CCGGGTCATTCATTGGAAACCGCAACTCGAGTTGCGGTTTCCAATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-279s1c1
Sequence:CCGGGCCAAGACAGATTTCAAGGCACTCGAGTGCCTTGAAATCTGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198485
TPRG1 MISSION shRNA shRNA Plasmid DNA
tumor protein p63 regulated 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198485.3-1356s21c1
Sequence:CCGGAGCCCTCTTATCCTGATTTATCTCGAGATAAATCAGGATAAGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198485.3-1389s21c1
Sequence:CCAGGTCTCACTGTCTCTAGTATTTCTCGAGAAATACTAGAGACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-465s1c1
Sequence:CCGGGACAAAGATAGACCACTGGAACTCGAGTTCCAGTGGTCTATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198485.1-3024s1c1
Sequence:CCGGCCAGTCTGTAACAATGGGATACTCGAGTATCCCATTGTTACAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198485.1-519s1c1
Sequence:CCGGCAAGACTCTCTTGATCTGCAACTCGAGTTGCAGATCAAGAGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-933s1c1
Sequence:CCGGGTCATTCATTGGAAACCGCAACTCGAGTTGCGGTTTCCAATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-279s1c1
Sequence:CCGGGCCAAGACAGATTTCAAGGCACTCGAGTGCCTTGAAATCTGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198485
TPRG1 MISSION shRNA Lentiviral Transduction Particles
tumor protein p63 regulated 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198485.3-1356s21c1
Sequence:CCGGAGCCCTCTTATCCTGATTTATCTCGAGATAAATCAGGATAAGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198485.3-1389s21c1
Sequence:CCAGGTCTCACTGTCTCTAGTATTTCTCGAGAAATACTAGAGACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-465s1c1
Sequence:CCGGGACAAAGATAGACCACTGGAACTCGAGTTCCAGTGGTCTATCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198485.1-3024s1c1
Sequence:CCGGCCAGTCTGTAACAATGGGATACTCGAGTATCCCATTGTTACAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198485.1-519s1c1
Sequence:CCGGCAAGACTCTCTTGATCTGCAACTCGAGTTGCAGATCAAGAGAGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-933s1c1
Sequence:CCGGGTCATTCATTGGAAACCGCAACTCGAGTTGCGGTTTCCAATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198485.1-279s1c1
Sequence:CCGGGCCAAGACAGATTTCAAGGCACTCGAGTGCCTTGAAATCTGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks