EMAIL THIS PAGE TO A FRIEND

TPRG1L

tumor protein p63 regulated 1-like

Synonyms: FAM79A RP11-46F15.3 h-mover mover
UniProtKB ID: Q5T0D9, A8K1K4, Q8WV04
Gene ID:
Rat(687090) tumor protein p63 regulated 1-like
Zebrafish(568867) tumor protein p63 regulated 1-like
chicken(419384) tumor protein p63 regulated 1-like
dog(479583) tumor protein p63 regulated 1-like
domestic cat(101091383) tumor protein p63 regulated 1-like
domestic guinea pig(100728247) tumor protein p63 regulated 1-like
naked mole-rat(101717273) tumor protein p63 regulated 1-like
cow(616333) tumor protein p63 regulated 1-like
sheep(101119235) tumor protein p63 regulated 1-like
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182752 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062181 MISSION® esiRNA esiRNA human TPRG1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182752 Rosetta Predictions human pricing
NM_001110318 Rosetta Predictions rat pricing
XR_009131 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036466 predicted 714
2 SASI_Hs01_00036467 predicted 1344
3 SASI_Hs01_00036468 predicted 1073
4 SASI_Hs01_00036469 predicted 1032
5 SASI_Hs01_00036470 predicted 824
6 SASI_Hs01_00036471 predicted 542
7 SASI_Hs01_00036472 predicted 1042
8 SASI_Hs01_00036473 predicted 703
9 SASI_Hs01_00036474 predicted 1063
10 SASI_Hs01_00036475 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251122 predicted 1229
2 SASI_Rn02_00251123 predicted 487
3 SASI_Rn02_00251124 predicted 892
4 SASI_Rn02_00251125 predicted 1035
5 SASI_Rn02_00251126 predicted 1050
6 SASI_Rn02_00251127 predicted 1043
7 SASI_Rn02_00251128 predicted 1163
8 SASI_Rn02_00251129 predicted 1083
9 SASI_Rn02_00251130 predicted 497
10 SASI_Rn02_00251131 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167030 predicted 1251
2 SASI_Rn01_00167031 predicted 1508
3 SASI_Rn01_00167032 predicted 1057
4 SASI_Rn01_00167033 predicted 1069
5 SASI_Rn01_00167034 predicted 1060
6 SASI_Rn01_00167035 predicted 1178
7 SASI_Rn01_00167036 predicted 1449
8 SASI_Rn01_00167037 predicted 1105
9 SASI_Rn01_00167038 predicted 805
10 SASI_Rn01_00167039 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182752
VALIDATED
TPRG1L MISSION shRNA Bacterial Glycerol Stock
tumor protein p63 regulated 1-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182752.2-1673s1c1
Sequence:CCGGGCTTGTTGAATAATGCACTTTCTCGAGAAAGTGCATTATTCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182752.2-533s1c1
Sequence:CCGGGCTCAACAAGCGAGAAGGTTTCTCGAGAAACCTTCTCGCTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182752.2-485s1c1
Sequence:CCGGCGCAGTAGACACCATTTCCTACTCGAGTAGGAAATGGTGTCTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-592s21c1
Sequence:CCGGAGTCGTCCTTCCTTCATAAACCTCGAGGTTTATGAAGGAAGGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182752.3-492s21c1
Sequence:CCGGCAACGCAGTAGACACCATTTCCTCGAGGAAATGGTGTCTACTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-1100s21c1
Sequence:CCGGTATTGGACTCTGCTCATATAACTCGAGTTATATGAGCAGAGTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-827s21c1
Sequence:CCGGTGGGACTCATGTCCTTCATTACTCGAGTAATGAAGGACATGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-424s21c1
Sequence:CCGGCAGTCCCTGCTTATCTGTAAACTCGAGTTTACAGATAAGCAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182752
VALIDATED
TPRG1L MISSION shRNA shRNA Plasmid DNA
tumor protein p63 regulated 1-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182752.2-1673s1c1
Sequence:CCGGGCTTGTTGAATAATGCACTTTCTCGAGAAAGTGCATTATTCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182752.2-533s1c1
Sequence:CCGGGCTCAACAAGCGAGAAGGTTTCTCGAGAAACCTTCTCGCTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182752.2-485s1c1
Sequence:CCGGCGCAGTAGACACCATTTCCTACTCGAGTAGGAAATGGTGTCTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-592s21c1
Sequence:CCGGAGTCGTCCTTCCTTCATAAACCTCGAGGTTTATGAAGGAAGGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182752.3-492s21c1
Sequence:CCGGCAACGCAGTAGACACCATTTCCTCGAGGAAATGGTGTCTACTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-1100s21c1
Sequence:CCGGTATTGGACTCTGCTCATATAACTCGAGTTATATGAGCAGAGTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-827s21c1
Sequence:CCGGTGGGACTCATGTCCTTCATTACTCGAGTAATGAAGGACATGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-424s21c1
Sequence:CCGGCAGTCCCTGCTTATCTGTAAACTCGAGTTTACAGATAAGCAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182752
VALIDATED
TPRG1L MISSION shRNA Lentiviral Transduction Particles
tumor protein p63 regulated 1-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183160    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182752.2-1673s1c1
Sequence:CCGGGCTTGTTGAATAATGCACTTTCTCGAGAAAGTGCATTATTCAACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182752.2-533s1c1
Sequence:CCGGGCTCAACAAGCGAGAAGGTTTCTCGAGAAACCTTCTCGCTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182752.2-485s1c1
Sequence:CCGGCGCAGTAGACACCATTTCCTACTCGAGTAGGAAATGGTGTCTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-592s21c1
Sequence:CCGGAGTCGTCCTTCCTTCATAAACCTCGAGGTTTATGAAGGAAGGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182752.3-492s21c1
Sequence:CCGGCAACGCAGTAGACACCATTTCCTCGAGGAAATGGTGTCTACTGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-1100s21c1
Sequence:CCGGTATTGGACTCTGCTCATATAACTCGAGTTATATGAGCAGAGTCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-827s21c1
Sequence:CCGGTGGGACTCATGTCCTTCATTACTCGAGTAATGAAGGACATGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182752.3-424s21c1
Sequence:CCGGCAGTCCCTGCTTATCTGTAAACTCGAGTTTACAGATAAGCAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks