EMAIL THIS PAGE TO A FRIEND

TPRKB

TP53RK binding protein

UniProtKB ID: Q9Y3C4, D6W5H6, Q8IWR6, Q8IWR7, Q9H3K4
Gene ID:
Mouse(69786) Tp53rk binding protein
Rat(297411) Tp53rk binding protein
cow(519224) TP53RK binding protein
sheep(101113315) TP53RK binding protein
domestic guinea pig(100713831) TP53RK binding protein
Zebrafish(492501) Tp53rk binding protein
dog(475794) TP53RK binding protein
domestic cat(101082229) TP53RK binding protein
chicken(425906) TP53RK binding protein
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176842 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176842 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176842 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016058 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016058 Rosetta Predictions human pricing
NM_001013926 Rosetta Predictions rat pricing
NM_176842 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043022 predicted 459
2 SASI_Hs01_00043024 predicted 214
3 SASI_Hs01_00043025 predicted 219
4 SASI_Hs01_00043026 predicted 397
5 SASI_Hs01_00043027 predicted 389
6 SASI_Hs01_00043028 predicted 237
7 SASI_Hs01_00043029 predicted 320
8 SASI_Hs01_00043030 predicted 197
9 SASI_Hs01_00043031 predicted 205
10 SASI_Hs02_00348789 predicted 395
11 SASI_Hs01_00043023 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201221 predicted 538
2 SASI_Rn01_00074266 predicted 388
3 SASI_Rn01_00074267 predicted 249
4 SASI_Rn01_00074268 predicted 452
5 SASI_Rn01_00074269 predicted 264
6 SASI_Rn01_00074270 predicted 223
7 SASI_Rn01_00074271 predicted 235
8 SASI_Rn01_00074272 predicted 437
9 SASI_Rn01_00074273 predicted 519
10 SASI_Rn02_00201222 predicted 364
11 SASI_Rn01_00074274 predicted 545
12 SASI_Rn01_00074275 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176842 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346728 predicted 249
2 SASI_Mm02_00346729 predicted 1096
3 SASI_Mm02_00346730 predicted 354
4 SASI_Mm02_00346731 predicted 1105
5 SASI_Mm02_00346732 predicted 274
6 SASI_Mm02_00346733 predicted 444
7 SASI_Mm02_00346734 predicted 501
8 SASI_Mm02_00346735 predicted 1126
9 SASI_Mm02_00346736 predicted 419
10 SASI_Mm02_00346737 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176842
TPRKB MISSION shRNA Bacterial Glycerol Stock
TP53RK binding protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176842.2-435s1c1
Sequence:CCGGGCATTTCAGAAACTAACACTTCTCGAGAAGTGTTAGTTTCTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-280s1c1
Sequence:CCGGCAATGTGATTGTCGATCCATTCTCGAGAATGGATCGACAATCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-314s1c1
Sequence:CCGGGCAGCAAACAAAGCCGTTCATCTCGAGATGAACGGCTTTGTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176842.2-1272s1c1
Sequence:CCGGCCTGCTACAATTACTCAATATCTCGAGATATTGAGTAATTGTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-624s1c1
Sequence:CCGGCGTTATTGGATGCTATCATTTCTCGAGAAATGATAGCATCCAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176842.2-573s1c1
Sequence:CCGGCGGAAGTCAAGAAGATATATACTCGAGTATATATCTTCTTGACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176842.2-981s1c1
Sequence:CCGGGTCAAATCCTATCTCAATAAACTCGAGTTTATTGAGATAGGATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176842
TPRKB MISSION shRNA shRNA Plasmid DNA
TP53RK binding protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176842.2-435s1c1
Sequence:CCGGGCATTTCAGAAACTAACACTTCTCGAGAAGTGTTAGTTTCTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-280s1c1
Sequence:CCGGCAATGTGATTGTCGATCCATTCTCGAGAATGGATCGACAATCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-314s1c1
Sequence:CCGGGCAGCAAACAAAGCCGTTCATCTCGAGATGAACGGCTTTGTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176842.2-1272s1c1
Sequence:CCGGCCTGCTACAATTACTCAATATCTCGAGATATTGAGTAATTGTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-624s1c1
Sequence:CCGGCGTTATTGGATGCTATCATTTCTCGAGAAATGATAGCATCCAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176842.2-573s1c1
Sequence:CCGGCGGAAGTCAAGAAGATATATACTCGAGTATATATCTTCTTGACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176842.2-981s1c1
Sequence:CCGGGTCAAATCCTATCTCAATAAACTCGAGTTTATTGAGATAGGATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176842
TPRKB MISSION shRNA Lentiviral Transduction Particles
TP53RK binding protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176842.2-435s1c1
Sequence:CCGGGCATTTCAGAAACTAACACTTCTCGAGAAGTGTTAGTTTCTGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-280s1c1
Sequence:CCGGCAATGTGATTGTCGATCCATTCTCGAGAATGGATCGACAATCACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-314s1c1
Sequence:CCGGGCAGCAAACAAAGCCGTTCATCTCGAGATGAACGGCTTTGTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176842.2-1272s1c1
Sequence:CCGGCCTGCTACAATTACTCAATATCTCGAGATATTGAGTAATTGTAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176842.2-624s1c1
Sequence:CCGGCGTTATTGGATGCTATCATTTCTCGAGAAATGATAGCATCCAATAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176842.2-573s1c1
Sequence:CCGGCGGAAGTCAAGAAGATATATACTCGAGTATATATCTTCTTGACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216446    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_176842.2-981s1c1
Sequence:CCGGGTCAAATCCTATCTCAATAAACTCGAGTTTATTGAGATAGGATTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016058
VALIDATED
TPRKB MISSION shRNA Bacterial Glycerol Stock
TP53RK binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-216s1c1
Sequence:CCGGCCATCGATGGATCACTGATAACTCGAGTTATCAGTGATCCATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-217s1c1
Sequence:CCGGCATCGATGGATCACTGATAAACTCGAGTTTATCAGTGATCCATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-320s1c1
Sequence:CCGGACAAGAACTCTATCTACTGAACTCGAGTTCAGTAGATAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-181s1c1
Sequence:CCGGTGCGGGAGACTTGAGAAGAAACTCGAGTTTCTTCTCAAGTCTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016058.1-404s1c1
Sequence:CCGGGCAAATGACACTTCAATTCTACTCGAGTAGAATTGAAGTGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-186s21c1
Sequence:CCGGTGCGGGAGACTTGAGAAGAAACTCGAGTTTCTTCTCAAGTCTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-222s21c1
Sequence:CCGGCATCGATGGATCACTGATAAACTCGAGTTTATCAGTGATCCATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-325s21c1
Sequence:CCGGACAAGAACTCTATCTACTGAACTCGAGTTCAGTAGATAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-409s21c1
Sequence:CCGGGCAAATGACACTTCAATTCTACTCGAGTAGAATTGAAGTGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016058
VALIDATED
TPRKB MISSION shRNA shRNA Plasmid DNA
TP53RK binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-216s1c1
Sequence:CCGGCCATCGATGGATCACTGATAACTCGAGTTATCAGTGATCCATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-217s1c1
Sequence:CCGGCATCGATGGATCACTGATAAACTCGAGTTTATCAGTGATCCATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-320s1c1
Sequence:CCGGACAAGAACTCTATCTACTGAACTCGAGTTCAGTAGATAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-181s1c1
Sequence:CCGGTGCGGGAGACTTGAGAAGAAACTCGAGTTTCTTCTCAAGTCTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016058.1-404s1c1
Sequence:CCGGGCAAATGACACTTCAATTCTACTCGAGTAGAATTGAAGTGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-186s21c1
Sequence:CCGGTGCGGGAGACTTGAGAAGAAACTCGAGTTTCTTCTCAAGTCTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-222s21c1
Sequence:CCGGCATCGATGGATCACTGATAAACTCGAGTTTATCAGTGATCCATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-325s21c1
Sequence:CCGGACAAGAACTCTATCTACTGAACTCGAGTTCAGTAGATAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-409s21c1
Sequence:CCGGGCAAATGACACTTCAATTCTACTCGAGTAGAATTGAAGTGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016058
VALIDATED
TPRKB MISSION shRNA Lentiviral Transduction Particles
TP53RK binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-216s1c1
Sequence:CCGGCCATCGATGGATCACTGATAACTCGAGTTATCAGTGATCCATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-217s1c1
Sequence:CCGGCATCGATGGATCACTGATAAACTCGAGTTTATCAGTGATCCATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-320s1c1
Sequence:CCGGACAAGAACTCTATCTACTGAACTCGAGTTCAGTAGATAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016058.1-181s1c1
Sequence:CCGGTGCGGGAGACTTGAGAAGAAACTCGAGTTTCTTCTCAAGTCTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016058.1-404s1c1
Sequence:CCGGGCAAATGACACTTCAATTCTACTCGAGTAGAATTGAAGTGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-186s21c1
Sequence:CCGGTGCGGGAGACTTGAGAAGAAACTCGAGTTTCTTCTCAAGTCTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-222s21c1
Sequence:CCGGCATCGATGGATCACTGATAAACTCGAGTTTATCAGTGATCCATCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-325s21c1
Sequence:CCGGACAAGAACTCTATCTACTGAACTCGAGTTCAGTAGATAGAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016058.2-409s21c1
Sequence:CCGGGCAAATGACACTTCAATTCTACTCGAGTAGAATTGAAGTGTCATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks