EMAIL THIS PAGE TO A FRIEND

TPRN

taperin

Synonyms: C9orf75 DFNB79 RP11-350O14.7
UniProtKB ID: Q4KMQ1, B7ZKU5, Q5VSG5, Q5VSG6, Q6IPP2, Q8NCH2
Gene ID:
Human(286262) Summary: This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]
Mouse(97031) taperin
Rat(499749) taperin
chicken(417259) taperin
dog(606917) taperin
cow(100125320) taperin
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103485 Anti-C9ORF75 antibody produced in rabbit affinity isolated antibody guinea pig, human, rat, horse, mouse, bovine
western blot pricing
SAB2103870 Anti-C9ORF75 antibody produced in rabbit affinity isolated antibody mouse, bovine, rat, guinea pig, human, horse
western blot pricing
HPA020899 ANTI-TPRN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001128228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128228 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128228 Rosetta Predictions human pricing
NM_173691 Rosetta Predictions human pricing
NM_001024309 Rosetta Predictions rat pricing
NM_175286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330996 predicted 1888
2 SASI_Hs02_00330997 predicted 1936
3 SASI_Hs02_00330998 predicted 1180
4 SASI_Hs02_00330999 predicted 2015
5 SASI_Hs02_00331000 predicted 793
6 SASI_Hs02_00331001 predicted 686
7 SASI_Hs02_00331002 predicted 2031
8 SASI_Hs02_00331003 predicted 1175
9 SASI_Hs02_00331004 predicted 1894
10 SASI_Hs02_00331005 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013674 predicted 716
2 SASI_Hs01_00013676 predicted 753
3 SASI_Hs01_00013677 predicted 1675
4 SASI_Hs01_00013678 predicted 1550
5 SASI_Hs01_00013679 predicted 1519
6 SASI_Hs01_00013680 predicted 1700
7 SASI_Hs01_00013681 predicted 746
8 SASI_Hs01_00013682 predicted 1562
9 SASI_Hs01_00013683 predicted 1798
10 SASI_Hs02_00368636 predicted 890
11 SASI_Hs01_00013675 predicted 1596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100501 predicted 1096
2 SASI_Rn01_00100505 predicted 1275
3 SASI_Rn02_00202512 predicted 755
4 SASI_Rn02_00202513 predicted 1493
5 SASI_Rn02_00202514 predicted 747
6 SASI_Rn01_00100507 predicted 1673
7 SASI_Rn01_00100508 predicted 1475
8 SASI_Rn01_00100509 predicted 1527
9 SASI_Rn01_00100510 predicted 2267
10 SASI_Rn02_00202515 predicted 1664
11 SASI_Rn01_00100502 predicted 801
12 SASI_Rn01_00100503 predicted 1001
13 SASI_Rn01_00100504 predicted 333
14 SASI_Rn01_00100506 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346014 predicted 2478
2 SASI_Mm02_00346015 predicted 2284
3 SASI_Mm02_00346016 predicted 848
4 SASI_Mm02_00346017 predicted 835
5 SASI_Mm02_00346018 predicted 2342
6 SASI_Mm02_00346019 predicted 780
7 SASI_Mm02_00346020 predicted 1403
8 SASI_Mm02_00346021 predicted 1715
9 SASI_Mm02_00346022 predicted 1750
10 SASI_Mm02_00346023 predicted 1704
11 SASI_Mm01_00058023 predicted 1725
12 SASI_Mm01_00058024 predicted 1613
13 SASI_Mm01_00058025 predicted 1348
14 SASI_Mm01_00058026 predicted 1175
15 SASI_Mm01_00058027 predicted 1576
16 SASI_Mm01_00058028 predicted 1112
17 SASI_Mm01_00058029 predicted 1543
18 SASI_Mm01_00058030 predicted 2480
19 SASI_Mm01_00058031 predicted 1492
20 SASI_Mm01_00058032 predicted 2323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175286
VALIDATED
TPRN MISSION shRNA Bacterial Glycerol Stock
taperin
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175286.4-838s21c1
Sequence:CCGGGTCAATCGCTCGCTTTCTAATCTCGAGATTAGAAAGCGAGCGATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175286.4-1748s21c1
Sequence:CCGGCCCTTCAGGAGCCACACTTAACTCGAGTTAAGTGTGGCTCCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175286.4-1559s21c1
Sequence:CCGGGACTTCCAGTCACCTTCATTGCTCGAGCAATGAAGGTGACTGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175286.4-2604s21c1
Sequence:CCGGCCAGAGTGCTGTCGGAAATTTCTCGAGAAATTTCCGACAGCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175286.2-2537s1c1
Sequence:CCGGCCATACTGTCTCATCTGTGATCTCGAGATCACAGATGAGACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175286.2-1545s1c1
Sequence:CCGGCCAGTCACCTTCATTGATGAACTCGAGTTCATCAATGAAGGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175286
VALIDATED
TPRN MISSION shRNA shRNA Plasmid DNA
taperin
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175286.4-838s21c1
Sequence:CCGGGTCAATCGCTCGCTTTCTAATCTCGAGATTAGAAAGCGAGCGATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175286.4-1748s21c1
Sequence:CCGGCCCTTCAGGAGCCACACTTAACTCGAGTTAAGTGTGGCTCCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175286.4-1559s21c1
Sequence:CCGGGACTTCCAGTCACCTTCATTGCTCGAGCAATGAAGGTGACTGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175286.4-2604s21c1
Sequence:CCGGCCAGAGTGCTGTCGGAAATTTCTCGAGAAATTTCCGACAGCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175286.2-2537s1c1
Sequence:CCGGCCATACTGTCTCATCTGTGATCTCGAGATCACAGATGAGACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175286.2-1545s1c1
Sequence:CCGGCCAGTCACCTTCATTGATGAACTCGAGTTCATCAATGAAGGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175286
VALIDATED
TPRN MISSION shRNA Lentiviral Transduction Particles
taperin
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175286.4-838s21c1
Sequence:CCGGGTCAATCGCTCGCTTTCTAATCTCGAGATTAGAAAGCGAGCGATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175286.4-1748s21c1
Sequence:CCGGCCCTTCAGGAGCCACACTTAACTCGAGTTAAGTGTGGCTCCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175286.4-1559s21c1
Sequence:CCGGGACTTCCAGTCACCTTCATTGCTCGAGCAATGAAGGTGACTGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175286.4-2604s21c1
Sequence:CCGGCCAGAGTGCTGTCGGAAATTTCTCGAGAAATTTCCGACAGCACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175286.2-2537s1c1
Sequence:CCGGCCATACTGTCTCATCTGTGATCTCGAGATCACAGATGAGACAGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175286.2-1545s1c1
Sequence:CCGGCCAGTCACCTTCATTGATGAACTCGAGTTCATCAATGAAGGTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128228
TPRN MISSION shRNA Bacterial Glycerol Stock
taperin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-1463s21c1
Sequence:CCGGTGCATGAGATCGAGGTGATTGCTCGAGCAATCACCTCGATCTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128228.1-2042s21c1
Sequence:CCGGCTTGTTTGGCCTCACTGTATCCTCGAGGATACAGTGAGGCCAAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-1141s21c1
Sequence:CCGGGCCAAGAATAGCCGGGAATATCTCGAGATATTCCCGGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-695s21c1
Sequence:CCGGCCAACGACTCCTTCGAGATACCTCGAGGTATCTCGAAGGAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-785s21c1
Sequence:CCGGTCCGCGCAAACTCTCGAAATTCTCGAGAATTTCGAGAGTTTGCGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128228
TPRN MISSION shRNA shRNA Plasmid DNA
taperin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-1463s21c1
Sequence:CCGGTGCATGAGATCGAGGTGATTGCTCGAGCAATCACCTCGATCTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128228.1-2042s21c1
Sequence:CCGGCTTGTTTGGCCTCACTGTATCCTCGAGGATACAGTGAGGCCAAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-1141s21c1
Sequence:CCGGGCCAAGAATAGCCGGGAATATCTCGAGATATTCCCGGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-695s21c1
Sequence:CCGGCCAACGACTCCTTCGAGATACCTCGAGGTATCTCGAAGGAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-785s21c1
Sequence:CCGGTCCGCGCAAACTCTCGAAATTCTCGAGAATTTCGAGAGTTTGCGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128228
TPRN MISSION shRNA Lentiviral Transduction Particles
taperin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-1463s21c1
Sequence:CCGGTGCATGAGATCGAGGTGATTGCTCGAGCAATCACCTCGATCTCATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128228.1-2042s21c1
Sequence:CCGGCTTGTTTGGCCTCACTGTATCCTCGAGGATACAGTGAGGCCAAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-1141s21c1
Sequence:CCGGGCCAAGAATAGCCGGGAATATCTCGAGATATTCCCGGCTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-695s21c1
Sequence:CCGGCCAACGACTCCTTCGAGATACCTCGAGGTATCTCGAAGGAGTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128228.1-785s21c1
Sequence:CCGGTCCGCGCAAACTCTCGAAATTCTCGAGAATTTCGAGAGTTTGCGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks