EMAIL THIS PAGE TO A FRIEND

TPRX1

tetra-peptide repeat homeobox 1

Synonyms: TPRX
Species: Human TPRX1(284355)
UniProtKB ID: Q8N7U7, A5D8Y3, B2RPL5
Gene ID:
Human(284355) Summary: Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the TPRX homeobox gene family. [provided by RefSeq, Jul 2008]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198479 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039271 predicted 1361
2 SASI_Hs01_00039272 predicted 1287
3 SASI_Hs01_00039273 predicted 1277
4 SASI_Hs01_00039274 predicted 1338
5 SASI_Hs01_00039275 predicted 1345
6 SASI_Hs01_00039276 predicted 1281
7 SASI_Hs01_00039277 predicted 1360
8 SASI_Hs01_00039278 predicted 1357
9 SASI_Hs01_00039279 predicted 1347
10 SASI_Hs01_00039280 predicted 1282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198479
TPRX1 MISSION shRNA Bacterial Glycerol Stock
tetra-peptide repeat homeobox 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-1285s1c1
Sequence:CCGGCCAGGTTATTACTGGATTTATCTCGAGATAAATCCAGTAATAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-412s1c1
Sequence:CCGGCTGGCTCAATTCCAGGCCCAACTCGAGTTGGGCCTGGAATTGAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-1100s1c1
Sequence:CCGGCTTGCCAGACACCCAGTTATTCTCGAGAATAACTGGGTGTCTGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-859s21c1
Sequence:CCGGGCCCAATTATAGGCCCGATTCCTCGAGGAATCGGGCCTATAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-1180s21c1
Sequence:CCGGCCATGACCTCTCAGTACCAAGCTCGAGCTTGGTACTGAGAGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-1252s21c1
Sequence:CCGGAGGGTGGCTCTGTGAATGAAACTCGAGTTTCATTCACAGAGCCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198479.2-1533s21c1
Sequence:CCGGTCACTGGGATATCTGGCATTACTCGAGTAATGCCAGATATCCCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198479
TPRX1 MISSION shRNA shRNA Plasmid DNA
tetra-peptide repeat homeobox 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-1285s1c1
Sequence:CCGGCCAGGTTATTACTGGATTTATCTCGAGATAAATCCAGTAATAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-412s1c1
Sequence:CCGGCTGGCTCAATTCCAGGCCCAACTCGAGTTGGGCCTGGAATTGAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-1100s1c1
Sequence:CCGGCTTGCCAGACACCCAGTTATTCTCGAGAATAACTGGGTGTCTGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-859s21c1
Sequence:CCGGGCCCAATTATAGGCCCGATTCCTCGAGGAATCGGGCCTATAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-1180s21c1
Sequence:CCGGCCATGACCTCTCAGTACCAAGCTCGAGCTTGGTACTGAGAGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-1252s21c1
Sequence:CCGGAGGGTGGCTCTGTGAATGAAACTCGAGTTTCATTCACAGAGCCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198479.2-1533s21c1
Sequence:CCGGTCACTGGGATATCTGGCATTACTCGAGTAATGCCAGATATCCCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198479
TPRX1 MISSION shRNA Lentiviral Transduction Particles
tetra-peptide repeat homeobox 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-1285s1c1
Sequence:CCGGCCAGGTTATTACTGGATTTATCTCGAGATAAATCCAGTAATAACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-412s1c1
Sequence:CCGGCTGGCTCAATTCCAGGCCCAACTCGAGTTGGGCCTGGAATTGAGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198479.1-1100s1c1
Sequence:CCGGCTTGCCAGACACCCAGTTATTCTCGAGAATAACTGGGTGTCTGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-859s21c1
Sequence:CCGGGCCCAATTATAGGCCCGATTCCTCGAGGAATCGGGCCTATAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-1180s21c1
Sequence:CCGGCCATGACCTCTCAGTACCAAGCTCGAGCTTGGTACTGAGAGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198479.2-1252s21c1
Sequence:CCGGAGGGTGGCTCTGTGAATGAAACTCGAGTTTCATTCACAGAGCCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198479.2-1533s21c1
Sequence:CCGGTCACTGGGATATCTGGCATTACTCGAGTAATGCCAGATATCCCAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks