EMAIL THIS PAGE TO A FRIEND

TPSAB1

tryptase alpha/beta 1

Synonyms: TPS1 TPS2 TPSB1
Gene ID:
Human(7177) Summary: Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, alpha and beta 1. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
Mouse(100503895) tryptase alpha/beta 1
Rat(54271) tryptase alpha/beta 1
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003294 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU207751 MISSION® esiRNA esiRNA targeting mouse Tpsab1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003294 Rosetta Predictions human pricing
NM_019322 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105375 predicted 431
2 SASI_Hs02_00335375 predicted 562
3 SASI_Hs01_00105378 predicted 659
4 SASI_Hs01_00105379 predicted 685
5 SASI_Hs01_00105380 predicted 685
6 SASI_Hs01_00105381 predicted 378
7 SASI_Hs01_00105384 predicted 694
8 SASI_Hs02_00335376 predicted 255
9 SASI_Hs02_00335377 predicted 668
10 SASI_Hs02_00335378 predicted 556
11 SASI_Hs01_00105376 predicted 374
12 SASI_Hs01_00105377 predicted 206
13 SASI_Hs01_00105382 predicted 376
14 SASI_Hs01_00105383 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059628 predicted 809
2 SASI_Rn01_00059629 predicted 790
3 SASI_Rn01_00059630 predicted 358
4 SASI_Rn01_00059631 predicted 956
5 SASI_Rn01_00059632 predicted 805
6 SASI_Rn01_00059633 predicted 706
7 SASI_Rn02_00262295 predicted 202
8 SASI_Rn01_00059634 predicted 466
9 SASI_Rn01_00059635 predicted 971
10 SASI_Rn01_00059636 predicted 477
11 SASI_Rn01_00059637 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003294
TPSAB1 MISSION shRNA Bacterial Glycerol Stock
tryptase alpha/beta 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-397s1c1
Sequence:CCGGCGCCCAGATCGGAGCGGACATCTCGAGATGTCCGCTCCGATCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-813s1c1
Sequence:CCGGCTGGCATCTACACCCGTGTCACTCGAGTGACACGGGTGTAGATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-385s1c1
Sequence:CCGGACAGTTCTACACCGCCCAGATCTCGAGATCTGGGCGGTGTAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-542s1c1
Sequence:CCGGGACAATGATGAGCGCCTCCCACTCGAGTGGGAGGCGCTCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-658s1c1
Sequence:CCGGCCGCATCGTCCGTGACGACATCTCGAGATGTCGTCACGGACGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003294
TPSAB1 MISSION shRNA shRNA Plasmid DNA
tryptase alpha/beta 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-397s1c1
Sequence:CCGGCGCCCAGATCGGAGCGGACATCTCGAGATGTCCGCTCCGATCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-813s1c1
Sequence:CCGGCTGGCATCTACACCCGTGTCACTCGAGTGACACGGGTGTAGATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-385s1c1
Sequence:CCGGACAGTTCTACACCGCCCAGATCTCGAGATCTGGGCGGTGTAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-542s1c1
Sequence:CCGGGACAATGATGAGCGCCTCCCACTCGAGTGGGAGGCGCTCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-658s1c1
Sequence:CCGGCCGCATCGTCCGTGACGACATCTCGAGATGTCGTCACGGACGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003294
TPSAB1 MISSION shRNA Lentiviral Transduction Particles
tryptase alpha/beta 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-397s1c1
Sequence:CCGGCGCCCAGATCGGAGCGGACATCTCGAGATGTCCGCTCCGATCTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-813s1c1
Sequence:CCGGCTGGCATCTACACCCGTGTCACTCGAGTGACACGGGTGTAGATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-385s1c1
Sequence:CCGGACAGTTCTACACCGCCCAGATCTCGAGATCTGGGCGGTGTAGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-542s1c1
Sequence:CCGGGACAATGATGAGCGCCTCCCACTCGAGTGGGAGGCGCTCATCATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003294.2-658s1c1
Sequence:CCGGCCGCATCGTCCGTGACGACATCTCGAGATGTCGTCACGGACGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks