EMAIL THIS PAGE TO A FRIEND

TPSB2

tryptase beta 2 (gene/pseudogene)

Synonyms: TPS2 tryptaseB tryptaseC
Gene ID:
Human(64499) Summary: Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. These genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. The alleles of this gene exhibit an unusual amount of sequence variation, such that the alleles were once thought to represent two separate genes, beta II and beta III. Beta tryptases appear to be the main isoenzymes expressed in mast cells, whereas in basophils, alpha-tryptases predominate. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
Mouse(17229) tryptase beta 2
Rat(29268) tryptase beta 2
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301600 Anti-TPSB2 affinity isolated antibody human
immunohistochemistry pricing

Proteins

Product # Description Species Add to Cart
 
T7063 Tryptase from human lung buffered aqueous solution, ≥5 units/mg protein human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109041 MISSION® esiRNA esiRNA human TPSB2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024164 Rosetta Predictions human pricing
NM_019180 Rosetta Predictions rat pricing
NM_010781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034259 predicted 405
2 SASI_Hs02_00356616 predicted 529
3 SASI_Hs01_00034261 predicted 626
4 SASI_Hs01_00034262 predicted 861
5 SASI_Hs01_00034263 predicted 654
6 SASI_Hs01_00034265 predicted 659
7 SASI_Hs01_00034267 predicted 350
8 SASI_Hs02_00356617 predicted 668
9 SASI_Hs02_00356618 predicted 225
10 SASI_Hs02_00356619 predicted 642
11 SASI_Hs01_00034260 predicted 341
12 SASI_Hs01_00034264 predicted 809
13 SASI_Hs01_00034266 predicted 803
14 SASI_Hs01_00034268 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077203 predicted 282
2 SASI_Rn01_00077204 predicted 819
3 SASI_Rn01_00077205 predicted 238
4 SASI_Rn01_00077206 predicted 692
5 SASI_Rn01_00077207 predicted 770
6 SASI_Rn01_00077208 predicted 802
7 SASI_Rn01_00077209 predicted 776
8 SASI_Rn01_00077210 predicted 608
9 SASI_Rn01_00077211 predicted 848
10 SASI_Rn01_00077212 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164685 predicted 590
2 SASI_Mm02_00319337 predicted 527
3 SASI_Mm02_00319338 predicted 402
4 SASI_Mm01_00164687 predicted 593
5 SASI_Mm01_00164688 predicted 524
6 SASI_Mm01_00164690 predicted 262
7 SASI_Mm01_00164693 predicted 688
8 SASI_Mm02_00319339 predicted 617
9 SASI_Mm01_00164694 predicted 633
10 SASI_Mm02_00319340 predicted 593
11 SASI_Mm01_00164686 predicted 284
12 SASI_Mm01_00164689 predicted 842
13 SASI_Mm01_00164691 predicted 816
14 SASI_Mm01_00164692 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024164
TPSB2 MISSION shRNA Bacterial Glycerol Stock
tryptase beta 2 (gene/pseudogene)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-514s1c1
Sequence:CCGGCCCACCGCCATTTCCTCTGAACTCGAGTTCAGAGGAAATGGCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-310s1c1
Sequence:CCGGGCTGCCGGTCAGCAGGATCATCTCGAGATGATCCTGCTGACCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-787s1c1
Sequence:CCGGCACCTACTACTTGGACTGGATCTCGAGATCCAGTCCAAGTAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-160s1c1
Sequence:CCGGCGGCCCATACTGGATGCACTTCTCGAGAAGTGCATCCAGTATGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-628s1c1
Sequence:CCGGCGACATGCTGTGTGCCGGGAACTCGAGTTCCCGGCACACAGCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-344s21c1
Sequence:CCGGCATCGTGCACCCACAGTTCTACTCGAGTAGAACTGTGGGTGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-791s21c1
Sequence:CCGGCTACACCCGTGTCACCTACTACTCGAGTAGTAGGTGACACGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-503s21c1
Sequence:CCGGGGGCGATGTGGACAATGATGACTCGAGTCATCATTGTCCACATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-814s21c1
Sequence:CCGGTGGACTGGATCCACCACTATGCTCGAGCATAGTGGTGGATCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024164
TPSB2 MISSION shRNA shRNA Plasmid DNA
tryptase beta 2 (gene/pseudogene)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-514s1c1
Sequence:CCGGCCCACCGCCATTTCCTCTGAACTCGAGTTCAGAGGAAATGGCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-310s1c1
Sequence:CCGGGCTGCCGGTCAGCAGGATCATCTCGAGATGATCCTGCTGACCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-787s1c1
Sequence:CCGGCACCTACTACTTGGACTGGATCTCGAGATCCAGTCCAAGTAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-160s1c1
Sequence:CCGGCGGCCCATACTGGATGCACTTCTCGAGAAGTGCATCCAGTATGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-628s1c1
Sequence:CCGGCGACATGCTGTGTGCCGGGAACTCGAGTTCCCGGCACACAGCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-344s21c1
Sequence:CCGGCATCGTGCACCCACAGTTCTACTCGAGTAGAACTGTGGGTGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-791s21c1
Sequence:CCGGCTACACCCGTGTCACCTACTACTCGAGTAGTAGGTGACACGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-503s21c1
Sequence:CCGGGGGCGATGTGGACAATGATGACTCGAGTCATCATTGTCCACATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-814s21c1
Sequence:CCGGTGGACTGGATCCACCACTATGCTCGAGCATAGTGGTGGATCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024164
TPSB2 MISSION shRNA Lentiviral Transduction Particles
tryptase beta 2 (gene/pseudogene)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-514s1c1
Sequence:CCGGCCCACCGCCATTTCCTCTGAACTCGAGTTCAGAGGAAATGGCGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-310s1c1
Sequence:CCGGGCTGCCGGTCAGCAGGATCATCTCGAGATGATCCTGCTGACCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-787s1c1
Sequence:CCGGCACCTACTACTTGGACTGGATCTCGAGATCCAGTCCAAGTAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-160s1c1
Sequence:CCGGCGGCCCATACTGGATGCACTTCTCGAGAAGTGCATCCAGTATGGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024164.2-628s1c1
Sequence:CCGGCGACATGCTGTGTGCCGGGAACTCGAGTTCCCGGCACACAGCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-344s21c1
Sequence:CCGGCATCGTGCACCCACAGTTCTACTCGAGTAGAACTGTGGGTGCACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-791s21c1
Sequence:CCGGCTACACCCGTGTCACCTACTACTCGAGTAGTAGGTGACACGGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-503s21c1
Sequence:CCGGGGGCGATGTGGACAATGATGACTCGAGTCATCATTGTCCACATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024164.5-814s21c1
Sequence:CCGGTGGACTGGATCCACCACTATGCTCGAGCATAGTGGTGGATCCAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010781
TPSB2 MISSION shRNA Bacterial Glycerol Stock
tryptase beta 2 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010781.1-763s1c1
Sequence:CCGGGCCTCATCCTTGATGGGAAATCTCGAGATTTCCCATCAAGGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-279s1c1
Sequence:CCGGCGTGAGCAGTATCTATACTATCTCGAGATAGTATAGATACTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-110s1c1
Sequence:CCGGACATGAGGCTTCTGAGAGTAACTCGAGTTACTCTCAGAAGCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-668s1c1
Sequence:CCGGCCAGCCATTCTGTATTGGAGACTCGAGTCTCCAATACAGAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-528s1c1
Sequence:CCGGCCTCTGAAGCAAGTGAAGGTTCTCGAGAACCTTCACTTGCTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010781
TPSB2 MISSION shRNA shRNA Plasmid DNA
tryptase beta 2 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010781.1-763s1c1
Sequence:CCGGGCCTCATCCTTGATGGGAAATCTCGAGATTTCCCATCAAGGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-279s1c1
Sequence:CCGGCGTGAGCAGTATCTATACTATCTCGAGATAGTATAGATACTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-110s1c1
Sequence:CCGGACATGAGGCTTCTGAGAGTAACTCGAGTTACTCTCAGAAGCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-668s1c1
Sequence:CCGGCCAGCCATTCTGTATTGGAGACTCGAGTCTCCAATACAGAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-528s1c1
Sequence:CCGGCCTCTGAAGCAAGTGAAGGTTCTCGAGAACCTTCACTTGCTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010781
TPSB2 MISSION shRNA Lentiviral Transduction Particles
tryptase beta 2 (gene/pseudogene)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010781.1-763s1c1
Sequence:CCGGGCCTCATCCTTGATGGGAAATCTCGAGATTTCCCATCAAGGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-279s1c1
Sequence:CCGGCGTGAGCAGTATCTATACTATCTCGAGATAGTATAGATACTGCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-110s1c1
Sequence:CCGGACATGAGGCTTCTGAGAGTAACTCGAGTTACTCTCAGAAGCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-668s1c1
Sequence:CCGGCCAGCCATTCTGTATTGGAGACTCGAGTCTCCAATACAGAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010781.1-528s1c1
Sequence:CCGGCCTCTGAAGCAAGTGAAGGTTCTCGAGAACCTTCACTTGCTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks