EMAIL THIS PAGE TO A FRIEND

TPSD1

tryptase delta 1

Synonyms: MCP7-LIKE MCP7L1 MMCP-7L
Gene ID:
Human(23430) Summary: Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. Although this gene may be an exception, most of the tryptase genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. This gene was once considered to be a pseudogene, although it is now believed to be a functional gene that encodes a protein. [provided by RefSeq, Jul 2008]
cow(282098) tryptase delta 1
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012217 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127461 MISSION® esiRNA esiRNA human TPSD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012217 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143698 predicted 250
2 SASI_Hs01_00143699 predicted 612
3 SASI_Hs01_00143700 predicted 624
4 SASI_Hs01_00143701 predicted 356
5 SASI_Hs01_00143702 predicted 349
6 SASI_Hs01_00143703 predicted 612
7 SASI_Hs01_00143704 predicted 576
8 SASI_Hs01_00143705 predicted 604
9 SASI_Hs01_00143706 predicted 617
10 SASI_Hs02_00343888 predicted 586
11 SASI_Hs01_00143697 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012217
TPSD1 MISSION shRNA Bacterial Glycerol Stock
tryptase delta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-420s21c1
Sequence:CCGGCGTGAACATCTCCAGCCACATCTCGAGATGTGGCTGGAGATGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-603s21c1
Sequence:CCGGATATCACACCGGCCTCCATACCTCGAGGTATGGAGGCCGGTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-621s21c1
Sequence:CCGGTACGGGCCACAGCTTTCAAATCTCGAGATTTGAAAGCTGTGGCCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-636s21c1
Sequence:CCGGTCAAATCGTCCGCGATGACATCTCGAGATGTCATCGCGGACGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-577s1c1
Sequence:CCGGCACCTTTGCAACGCGGAATATCTCGAGATATTCCGCGTTGCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-351s1c1
Sequence:CCGGCCCACAGTTCTACATCATCCACTCGAGTGGATGATGTAGAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-507s1c1
Sequence:CCGGCGTGGACAATAATGTGCACCTCTCGAGAGGTGCACATTATTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-96s1c1
Sequence:CCGGCCTGCAGCAAACGGGCATTGTCTCGAGACAATGCCCGTTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-531s1c1
Sequence:CCGGGCCGCCATACCCGCTGAAGGACTCGAGTCCTTCAGCGGGTATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012217
TPSD1 MISSION shRNA shRNA Plasmid DNA
tryptase delta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-420s21c1
Sequence:CCGGCGTGAACATCTCCAGCCACATCTCGAGATGTGGCTGGAGATGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-603s21c1
Sequence:CCGGATATCACACCGGCCTCCATACCTCGAGGTATGGAGGCCGGTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-621s21c1
Sequence:CCGGTACGGGCCACAGCTTTCAAATCTCGAGATTTGAAAGCTGTGGCCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-636s21c1
Sequence:CCGGTCAAATCGTCCGCGATGACATCTCGAGATGTCATCGCGGACGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-577s1c1
Sequence:CCGGCACCTTTGCAACGCGGAATATCTCGAGATATTCCGCGTTGCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-351s1c1
Sequence:CCGGCCCACAGTTCTACATCATCCACTCGAGTGGATGATGTAGAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-507s1c1
Sequence:CCGGCGTGGACAATAATGTGCACCTCTCGAGAGGTGCACATTATTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-96s1c1
Sequence:CCGGCCTGCAGCAAACGGGCATTGTCTCGAGACAATGCCCGTTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-531s1c1
Sequence:CCGGGCCGCCATACCCGCTGAAGGACTCGAGTCCTTCAGCGGGTATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012217
TPSD1 MISSION shRNA Lentiviral Transduction Particles
tryptase delta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-420s21c1
Sequence:CCGGCGTGAACATCTCCAGCCACATCTCGAGATGTGGCTGGAGATGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-603s21c1
Sequence:CCGGATATCACACCGGCCTCCATACCTCGAGGTATGGAGGCCGGTGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-621s21c1
Sequence:CCGGTACGGGCCACAGCTTTCAAATCTCGAGATTTGAAAGCTGTGGCCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012217.2-636s21c1
Sequence:CCGGTCAAATCGTCCGCGATGACATCTCGAGATGTCATCGCGGACGATTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-577s1c1
Sequence:CCGGCACCTTTGCAACGCGGAATATCTCGAGATATTCCGCGTTGCAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-351s1c1
Sequence:CCGGCCCACAGTTCTACATCATCCACTCGAGTGGATGATGTAGAACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-507s1c1
Sequence:CCGGCGTGGACAATAATGTGCACCTCTCGAGAGGTGCACATTATTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-96s1c1
Sequence:CCGGCCTGCAGCAAACGGGCATTGTCTCGAGACAATGCCCGTTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012217.1-531s1c1
Sequence:CCGGGCCGCCATACCCGCTGAAGGACTCGAGTCCTTCAGCGGGTATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks