EMAIL THIS PAGE TO A FRIEND

TPSG1

tryptase gamma 1

Synonyms: PRSS31 TMT trpA
UniProtKB ID: Q9NRR2, Q96RZ8, Q9C015, Q9NRQ8, Q9UBB2
Gene ID:
Human(25823) Summary: Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. There is uncertainty regarding the number of genes in this cluster. Currently four functional genes - alpha I, beta I, beta II and gamma I - have been identified. And beta I has an allelic variant named alpha II, beta II has an allelic variant beta III, also gamma I has an allelic variant gamma II. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha-tryptases predominant. This gene differs from other members of the tryptase gene family in that it has C-terminal hydrophobic domain, which may serve as a membrane anchor. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
Mouse(26945) tryptase gamma 1
Rat(302990) tryptase gamma 1
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012467 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041861 MISSION® esiRNA esiRNA targeting mouse Tpsg1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012467 Rosetta Predictions human pricing
NM_175593 Rosetta Predictions rat pricing
NM_012034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344381 predicted 229
2 SASI_Hs01_00147522 predicted 527
3 SASI_Hs01_00147523 predicted 596
4 SASI_Hs01_00147524 predicted 566
5 SASI_Hs01_00147525 predicted 561
6 SASI_Hs01_00147526 predicted 231
7 SASI_Hs01_00147527 predicted 320
8 SASI_Hs01_00147529 predicted 486
9 SASI_Hs01_00147530 predicted 768
10 SASI_Hs02_00344382 predicted 253
11 SASI_Hs01_00147528 predicted 286
12 SASI_Hs01_00147531 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175593 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031028 predicted 275
2 SASI_Rn01_00031029 predicted 285
3 SASI_Rn01_00031030 predicted 271
4 SASI_Rn01_00031031 predicted 226
5 SASI_Rn01_00031032 predicted 297
6 SASI_Rn01_00031033 predicted 741
7 SASI_Rn01_00031034 predicted 577
8 SASI_Rn01_00031035 predicted 218
9 SASI_Rn01_00031036 predicted 421
10 SASI_Rn01_00031037 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116467 predicted 698
2 SASI_Mm01_00116468 predicted 936
3 SASI_Mm01_00116469 predicted 581
4 SASI_Mm01_00116470 predicted 294
5 SASI_Mm01_00116471 predicted 286
6 SASI_Mm01_00116472 predicted 315
7 SASI_Mm02_00322002 predicted 588
8 SASI_Mm01_00116473 predicted 809
9 SASI_Mm01_00116474 predicted 806
10 SASI_Mm01_00116475 predicted 375
11 SASI_Mm01_00116476 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012034
TPSG1 MISSION shRNA Bacterial Glycerol Stock
tryptase gamma 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012034.2-1023s1c1
Sequence:CCGGCCCAAGTGTCTTTCTTAAATACTCGAGTATTTAAGAAAGACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-290s1c1
Sequence:CCGGGTCTGTGAACTCGTCTGATTACTCGAGTAATCAGACGAGTTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-130s1c1
Sequence:CCGGCCCAGGTTTCAAACTCGGGAACTCGAGTTCCCGAGTTTGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-812s1c1
Sequence:CCGGCCGGGTTACTGCCTATGTAAACTCGAGTTTACATAGGCAGTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-623s1c1
Sequence:CCGGCCAGGCTTACAATAGTCCCAACTCGAGTTGGGACTATTGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012034.3-977s21c1
Sequence:CCGGGAGTCCTGATGGCCAAGTACTCTCGAGAGTACTTGGCCATCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012034.3-280s21c1
Sequence:CCGGAGTCCAGAATGGGTGCTCACACTCGAGTGTGAGCACCCATTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012034
TPSG1 MISSION shRNA shRNA Plasmid DNA
tryptase gamma 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012034.2-1023s1c1
Sequence:CCGGCCCAAGTGTCTTTCTTAAATACTCGAGTATTTAAGAAAGACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-290s1c1
Sequence:CCGGGTCTGTGAACTCGTCTGATTACTCGAGTAATCAGACGAGTTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-130s1c1
Sequence:CCGGCCCAGGTTTCAAACTCGGGAACTCGAGTTCCCGAGTTTGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-812s1c1
Sequence:CCGGCCGGGTTACTGCCTATGTAAACTCGAGTTTACATAGGCAGTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-623s1c1
Sequence:CCGGCCAGGCTTACAATAGTCCCAACTCGAGTTGGGACTATTGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012034.3-977s21c1
Sequence:CCGGGAGTCCTGATGGCCAAGTACTCTCGAGAGTACTTGGCCATCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012034.3-280s21c1
Sequence:CCGGAGTCCAGAATGGGTGCTCACACTCGAGTGTGAGCACCCATTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012034
TPSG1 MISSION shRNA Lentiviral Transduction Particles
tryptase gamma 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012034.2-1023s1c1
Sequence:CCGGCCCAAGTGTCTTTCTTAAATACTCGAGTATTTAAGAAAGACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-290s1c1
Sequence:CCGGGTCTGTGAACTCGTCTGATTACTCGAGTAATCAGACGAGTTCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-130s1c1
Sequence:CCGGCCCAGGTTTCAAACTCGGGAACTCGAGTTCCCGAGTTTGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-812s1c1
Sequence:CCGGCCGGGTTACTGCCTATGTAAACTCGAGTTTACATAGGCAGTAACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012034.2-623s1c1
Sequence:CCGGCCAGGCTTACAATAGTCCCAACTCGAGTTGGGACTATTGTAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012034.3-977s21c1
Sequence:CCGGGAGTCCTGATGGCCAAGTACTCTCGAGAGTACTTGGCCATCAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012034.3-280s21c1
Sequence:CCGGAGTCCAGAATGGGTGCTCACACTCGAGTGTGAGCACCCATTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012467
TPSG1 MISSION shRNA Bacterial Glycerol Stock
tryptase gamma 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-360s1c1
Sequence:CCGGGAACTGGAGATCACTTTGTCTCTCGAGAGACAAAGTGATCTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-479s1c1
Sequence:CCGGCGTGACCCTCTCCAGCCGGATCTCGAGATCCGGCTGGAGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-851s1c1
Sequence:CCGGCCCTGCCTACGTGAACTGGATCTCGAGATCCAGTTCACGTAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-326s1c1
Sequence:CCGGCCTGAACTCATCCGACTACCACTCGAGTGGTAGTCGGATGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-1000s1c1
Sequence:CCGGTGCACCCATCTGCGGATGGTACTCGAGTACCATCCGCAGATGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012467
TPSG1 MISSION shRNA shRNA Plasmid DNA
tryptase gamma 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-360s1c1
Sequence:CCGGGAACTGGAGATCACTTTGTCTCTCGAGAGACAAAGTGATCTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-479s1c1
Sequence:CCGGCGTGACCCTCTCCAGCCGGATCTCGAGATCCGGCTGGAGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-851s1c1
Sequence:CCGGCCCTGCCTACGTGAACTGGATCTCGAGATCCAGTTCACGTAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-326s1c1
Sequence:CCGGCCTGAACTCATCCGACTACCACTCGAGTGGTAGTCGGATGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-1000s1c1
Sequence:CCGGTGCACCCATCTGCGGATGGTACTCGAGTACCATCCGCAGATGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012467
TPSG1 MISSION shRNA Lentiviral Transduction Particles
tryptase gamma 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-360s1c1
Sequence:CCGGGAACTGGAGATCACTTTGTCTCTCGAGAGACAAAGTGATCTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-479s1c1
Sequence:CCGGCGTGACCCTCTCCAGCCGGATCTCGAGATCCGGCTGGAGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-851s1c1
Sequence:CCGGCCCTGCCTACGTGAACTGGATCTCGAGATCCAGTTCACGTAGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-326s1c1
Sequence:CCGGCCTGAACTCATCCGACTACCACTCGAGTGGTAGTCGGATGAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012467.1-1000s1c1
Sequence:CCGGTGCACCCATCTGCGGATGGTACTCGAGTACCATCCGCAGATGGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks