EMAIL THIS PAGE TO A FRIEND

TPST1

tyrosylprotein sulfotransferase 1

Synonyms: TANGO13A
UniProtKB ID: O60507, Q6FGM7
Gene ID:
Mouse(22021) protein-tyrosine sulfotransferase 1
Rat(288617) tyrosylprotein sulfotransferase 1
Zebrafish(30677) tyrosylprotein sulfotransferase 1
chicken(417546) tyrosylprotein sulfotransferase 1
dog(489788) tyrosylprotein sulfotransferase 1
Horse(100061873) tyrosylprotein sulfotransferase 1
domestic cat(101101278) tyrosylprotein sulfotransferase 1
domestic guinea pig(100721220) tyrosylprotein sulfotransferase 1
naked mole-rat(101711599) tyrosylprotein sulfotransferase 1
Domestic Rabbit(100345464) tyrosylprotein sulfotransferase 1
cow(513004) tyrosylprotein sulfotransferase 1
sheep(101110019) tyrosylprotein sulfotransferase 1
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003596 Rosetta Predictions human pricing
NM_001011903 Rosetta Predictions rat pricing
XM_573390 Rosetta Predictions rat pricing
NM_001130476 Rosetta Predictions mouse pricing
NM_013837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218992 predicted 1206
2 SASI_Hs01_00218993 predicted 976
3 SASI_Hs01_00218995 predicted 1386
4 SASI_Hs01_00218996 predicted 1289
5 SASI_Hs01_00218997 predicted 1040
6 SASI_Hs01_00218998 predicted 1089
7 SASI_Hs01_00218999 predicted 343
8 SASI_Hs01_00219000 predicted 982
9 SASI_Hs01_00219001 predicted 1372
10 SASI_Hs02_00335928 predicted 732
11 SASI_Hs01_00218994 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087968 predicted 814
2 SASI_Rn01_00087969 predicted 855
3 SASI_Rn01_00087970 predicted 956
4 SASI_Rn02_00199894 predicted 1002
5 SASI_Rn02_00199895 predicted 1006
6 SASI_Rn01_00087972 predicted 923
7 SASI_Rn01_00087973 predicted 930
8 SASI_Rn01_00087974 predicted 821
9 SASI_Rn01_00087976 predicted 585
10 SASI_Rn01_00087977 predicted 823
11 SASI_Rn01_00087971 predicted 1251
12 SASI_Rn01_00087975 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573390 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165686 predicted 560
2 SASI_Rn01_00165687 predicted 557
3 SASI_Rn01_00165688 predicted 582
4 SASI_Rn01_00165689 predicted 358
5 SASI_Rn01_00165690 predicted 478
6 SASI_Rn01_00165691 predicted 472
7 SASI_Rn01_00165692 predicted 592
8 SASI_Rn01_00165693 predicted 595
9 SASI_Rn01_00165694 predicted 442
10 SASI_Rn01_00165695 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311308 predicted 1317
2 SASI_Mm02_00311309 predicted 950
3 SASI_Mm02_00311310 predicted 878
4 SASI_Mm02_00311311 predicted 932
5 SASI_Mm02_00311312 predicted 1031
6 SASI_Mm02_00311313 predicted 462
7 SASI_Mm02_00311314 predicted 935
8 SASI_Mm02_00311315 predicted 778
9 SASI_Mm02_00311316 predicted 602
10 SASI_Mm02_00311317 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322833 predicted 1245
2 SASI_Mm01_00110053 predicted 882
3 SASI_Mm01_00110054 predicted 807
4 SASI_Mm01_00110055 predicted 859
5 SASI_Mm01_00110056 predicted 961
6 SASI_Mm01_00110057 predicted 395
7 SASI_Mm01_00110058 predicted 868
8 SASI_Mm01_00110059 predicted 711
9 SASI_Mm01_00110061 predicted 539
10 SASI_Mm02_00322834 predicted 1096
11 SASI_Mm01_00110052 predicted 415
12 SASI_Mm01_00110060 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003596
VALIDATED
TPST1 MISSION shRNA Bacterial Glycerol Stock
tyrosylprotein sulfotransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-463s21c1
Sequence:CCGGACGTAGCCAGCCAGTCAAATTCTCGAGAATTTGACTGGCTGGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-854s21c1
Sequence:CCGGACTTACCTTTCTAGGTTATTCCTCGAGGAATAACCTAGAAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003596.3-1472s21c1
Sequence:CCGGCAGGAGCCTCTTCCATACATGCTCGAGCATGTATGGAAGAGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003596.3-1025s21c1
Sequence:CCGGCAGTGTATGGAGGTTGGTTATCTCGAGATAACCAACCTCCATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-689s21c1
Sequence:CCGGATGTGGTCACGGTCAAGTAAACTCGAGTTTACTTGACCGTGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1191s1c1
Sequence:CCGGCCAAGTAATCAAGCCAGTCAACTCGAGTTGACTGGCTTGATTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003596.2-518s1c1
Sequence:CCGGCCTATCACAAAGATATGCCTTCTCGAGAAGGCATATCTTTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-889s1c1
Sequence:CCGGGCATCAGTACATTCAATGATTCTCGAGAATCATTGAATGTACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1069s1c1
Sequence:CCGGCGGTGGATGAGAACACTCTTACTCGAGTAAGAGTGTTCTCATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1366s1c1
Sequence:CCGGCGAAGGGTCTATAAGGGAGAACTCGAGTTCTCCCTTATAGACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003596
VALIDATED
TPST1 MISSION shRNA shRNA Plasmid DNA
tyrosylprotein sulfotransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-463s21c1
Sequence:CCGGACGTAGCCAGCCAGTCAAATTCTCGAGAATTTGACTGGCTGGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-854s21c1
Sequence:CCGGACTTACCTTTCTAGGTTATTCCTCGAGGAATAACCTAGAAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003596.3-1472s21c1
Sequence:CCGGCAGGAGCCTCTTCCATACATGCTCGAGCATGTATGGAAGAGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003596.3-1025s21c1
Sequence:CCGGCAGTGTATGGAGGTTGGTTATCTCGAGATAACCAACCTCCATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-689s21c1
Sequence:CCGGATGTGGTCACGGTCAAGTAAACTCGAGTTTACTTGACCGTGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1191s1c1
Sequence:CCGGCCAAGTAATCAAGCCAGTCAACTCGAGTTGACTGGCTTGATTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003596.2-518s1c1
Sequence:CCGGCCTATCACAAAGATATGCCTTCTCGAGAAGGCATATCTTTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-889s1c1
Sequence:CCGGGCATCAGTACATTCAATGATTCTCGAGAATCATTGAATGTACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1069s1c1
Sequence:CCGGCGGTGGATGAGAACACTCTTACTCGAGTAAGAGTGTTCTCATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1366s1c1
Sequence:CCGGCGAAGGGTCTATAAGGGAGAACTCGAGTTCTCCCTTATAGACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003596
VALIDATED
TPST1 MISSION shRNA Lentiviral Transduction Particles
tyrosylprotein sulfotransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-463s21c1
Sequence:CCGGACGTAGCCAGCCAGTCAAATTCTCGAGAATTTGACTGGCTGGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-854s21c1
Sequence:CCGGACTTACCTTTCTAGGTTATTCCTCGAGGAATAACCTAGAAAGGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003596.3-1472s21c1
Sequence:CCGGCAGGAGCCTCTTCCATACATGCTCGAGCATGTATGGAAGAGGCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003596.3-1025s21c1
Sequence:CCGGCAGTGTATGGAGGTTGGTTATCTCGAGATAACCAACCTCCATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_003596.3-689s21c1
Sequence:CCGGATGTGGTCACGGTCAAGTAAACTCGAGTTTACTTGACCGTGACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1191s1c1
Sequence:CCGGCCAAGTAATCAAGCCAGTCAACTCGAGTTGACTGGCTTGATTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003596.2-518s1c1
Sequence:CCGGCCTATCACAAAGATATGCCTTCTCGAGAAGGCATATCTTTGTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-889s1c1
Sequence:CCGGGCATCAGTACATTCAATGATTCTCGAGAATCATTGAATGTACTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1069s1c1
Sequence:CCGGCGGTGGATGAGAACACTCTTACTCGAGTAAGAGTGTTCTCATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003596.2-1366s1c1
Sequence:CCGGCGAAGGGTCTATAAGGGAGAACTCGAGTTCTCCCTTATAGACCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013837
VALIDATED
TPST1 MISSION shRNA Bacterial Glycerol Stock
tyrosylprotein sulfotransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-1594s1c1
Sequence:CCGGCCAGTCTTTAATTTCAAGGAACTCGAGTTCCTTGAAATTAAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-773s1c1
Sequence:CCGGCGTCAGTACATTCAATGATTTCTCGAGAAATCATTGAATGTACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-555s1c1
Sequence:CCGGCCGGTCCAGTAAAGAGAAGATCTCGAGATCTTCTCTTTACTGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-967s1c1
Sequence:CCGGCTCTTAAAGTTCCTCCATATTCTCGAGAATATGGAGGAACTTTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-372s1c1
Sequence:CCGGCCTCGACATCAAAGCCAACAACTCGAGTTGTTGGCTTTGATGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013837
VALIDATED
TPST1 MISSION shRNA shRNA Plasmid DNA
tyrosylprotein sulfotransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-1594s1c1
Sequence:CCGGCCAGTCTTTAATTTCAAGGAACTCGAGTTCCTTGAAATTAAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-773s1c1
Sequence:CCGGCGTCAGTACATTCAATGATTTCTCGAGAAATCATTGAATGTACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-555s1c1
Sequence:CCGGCCGGTCCAGTAAAGAGAAGATCTCGAGATCTTCTCTTTACTGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-967s1c1
Sequence:CCGGCTCTTAAAGTTCCTCCATATTCTCGAGAATATGGAGGAACTTTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-372s1c1
Sequence:CCGGCCTCGACATCAAAGCCAACAACTCGAGTTGTTGGCTTTGATGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013837
VALIDATED
TPST1 MISSION shRNA Lentiviral Transduction Particles
tyrosylprotein sulfotransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-1594s1c1
Sequence:CCGGCCAGTCTTTAATTTCAAGGAACTCGAGTTCCTTGAAATTAAAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-773s1c1
Sequence:CCGGCGTCAGTACATTCAATGATTTCTCGAGAAATCATTGAATGTACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-555s1c1
Sequence:CCGGCCGGTCCAGTAAAGAGAAGATCTCGAGATCTTCTCTTTACTGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-967s1c1
Sequence:CCGGCTCTTAAAGTTCCTCCATATTCTCGAGAATATGGAGGAACTTTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_013837.1-372s1c1
Sequence:CCGGCCTCGACATCAAAGCCAACAACTCGAGTTGTTGGCTTTGATGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks