EMAIL THIS PAGE TO A FRIEND

TPST2

tyrosylprotein sulfotransferase 2

Synonyms: TANGO13B
UniProtKB ID: O60704, B3KQA7, Q6FI98, Q9H0V4
Gene ID:
Human(8459) Summary: The protein encoded by this gene catalyzes the O-sulfation of tyrosine residues within acidic regions of proteins. The encoded protein is a type II integral membrane protein found in the Golgi body. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(22022) protein-tyrosine sulfotransferase 2
Rat(288719) tyrosylprotein sulfotransferase 2
Zebrafish(393391) tyrosylprotein sulfotransferase 2
chicken(416910) tyrosylprotein sulfotransferase 2
dog(486332) tyrosylprotein sulfotransferase 2
domestic cat(101091155) tyrosylprotein sulfotransferase 2
cow(540183) tyrosylprotein sulfotransferase 2
sheep(101104858) tyrosylprotein sulfotransferase 2
naked mole-rat(101717396) tyrosylprotein sulfotransferase 2
domestic guinea pig(100721372) tyrosylprotein sulfotransferase 2
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021054 Anti-TPST2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2102525 Anti-TPST2 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rabbit, human, mouse, bovine, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003595 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008566 Rosetta Predictions human pricing
NM_003595 Rosetta Predictions human pricing
NM_001008508 Rosetta Predictions rat pricing
NM_009419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183512 predicted 1211
2 SASI_Hs02_00305507 predicted 818
3 SASI_Hs01_00183513 predicted 1451
4 SASI_Hs01_00183514 predicted 1466
5 SASI_Hs01_00183515 predicted 499
6 SASI_Hs01_00183516 predicted 397
7 SASI_Hs01_00183517 predicted 1518
8 SASI_Hs01_00183518 predicted 829
9 SASI_Hs01_00183519 predicted 825
10 SASI_Hs02_00305508 predicted 690
11 SASI_Hs01_00183520 predicted 1308
12 SASI_Hs01_00183521 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159922 predicted 1107
2 SASI_Hs02_00335926 predicted 702
3 SASI_Hs01_00159923 predicted 1345
4 SASI_Hs01_00159924 predicted 1360
5 SASI_Hs01_00159925 predicted 395
6 SASI_Hs01_00159926 predicted 292
7 SASI_Hs01_00159927 predicted 1407
8 SASI_Hs01_00159928 predicted 722
9 SASI_Hs01_00159929 predicted 711
10 SASI_Hs02_00335927 predicted 577
11 SASI_Hs01_00159930 predicted 1198
12 SASI_Hs01_00159931 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037378 predicted 348
2 SASI_Rn01_00037379 predicted 842
3 SASI_Rn01_00037380 predicted 645
4 SASI_Rn01_00037381 predicted 804
5 SASI_Rn01_00037382 predicted 753
6 SASI_Rn01_00037383 predicted 632
7 SASI_Rn02_00199180 predicted 930
8 SASI_Rn01_00037384 predicted 1179
9 SASI_Rn01_00037385 predicted 1119
10 SASI_Rn01_00037386 predicted 1218
11 SASI_Rn01_00037387 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125743 predicted 1170
2 SASI_Mm01_00125740 predicted 699
3 SASI_Mm01_00125742 predicted 860
4 SASI_Mm01_00125744 predicted 801
5 SASI_Mm01_00125745 predicted 1315
6 SASI_Mm01_00125746 predicted 892
7 SASI_Mm01_00125747 predicted 1230
8 SASI_Mm02_00316075 predicted 615
9 SASI_Mm02_00316076 predicted 1272
10 SASI_Mm01_00125748 predicted 877
11 SASI_Mm01_00125739 predicted 1589
12 SASI_Mm01_00125741 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009419
VALIDATED
TPST2 MISSION shRNA Bacterial Glycerol Stock
tyrosylprotein sulfotransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1523s1c1
Sequence:CCGGCGCTTCAGAAACTTGGAGATTCTCGAGAATCTCCAAGTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-720s1c1
Sequence:CCGGCAACTCCAAATTCCTGCTAATCTCGAGATTAGCAGGAATTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-718s1c1
Sequence:CCGGCCCAACTCCAAATTCCTGCTACTCGAGTAGCAGGAATTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1237s1c1
Sequence:CCGGCGGGTCTTGAAAGGAGACTATCTCGAGATAGTCTCCTTTCAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1265s1c1
Sequence:CCGGCAGCCAATCTGAAAGGATATTCTCGAGAATATCCTTTCAGATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009419.3-1532s21c1
Sequence:CCGGCGCTTCAGAAACTTGGAGATTCTCGAGAATCTCCAAGTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-1246s21c1
Sequence:CCGGCGGGTCTTGAAAGGAGACTATCTCGAGATAGTCTCCTTTCAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-1274s21c1
Sequence:CCGGCAGCCAATCTGAAAGGATATTCTCGAGAATATCCTTTCAGATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-727s21c1
Sequence:CCGGCCCAACTCCAAATTCCTGCTACTCGAGTAGCAGGAATTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009419
VALIDATED
TPST2 MISSION shRNA shRNA Plasmid DNA
tyrosylprotein sulfotransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1523s1c1
Sequence:CCGGCGCTTCAGAAACTTGGAGATTCTCGAGAATCTCCAAGTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-720s1c1
Sequence:CCGGCAACTCCAAATTCCTGCTAATCTCGAGATTAGCAGGAATTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-718s1c1
Sequence:CCGGCCCAACTCCAAATTCCTGCTACTCGAGTAGCAGGAATTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1237s1c1
Sequence:CCGGCGGGTCTTGAAAGGAGACTATCTCGAGATAGTCTCCTTTCAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1265s1c1
Sequence:CCGGCAGCCAATCTGAAAGGATATTCTCGAGAATATCCTTTCAGATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009419.3-1532s21c1
Sequence:CCGGCGCTTCAGAAACTTGGAGATTCTCGAGAATCTCCAAGTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-1246s21c1
Sequence:CCGGCGGGTCTTGAAAGGAGACTATCTCGAGATAGTCTCCTTTCAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-1274s21c1
Sequence:CCGGCAGCCAATCTGAAAGGATATTCTCGAGAATATCCTTTCAGATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-727s21c1
Sequence:CCGGCCCAACTCCAAATTCCTGCTACTCGAGTAGCAGGAATTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009419
VALIDATED
TPST2 MISSION shRNA Lentiviral Transduction Particles
tyrosylprotein sulfotransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1523s1c1
Sequence:CCGGCGCTTCAGAAACTTGGAGATTCTCGAGAATCTCCAAGTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-720s1c1
Sequence:CCGGCAACTCCAAATTCCTGCTAATCTCGAGATTAGCAGGAATTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-718s1c1
Sequence:CCGGCCCAACTCCAAATTCCTGCTACTCGAGTAGCAGGAATTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1237s1c1
Sequence:CCGGCGGGTCTTGAAAGGAGACTATCTCGAGATAGTCTCCTTTCAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009419.2-1265s1c1
Sequence:CCGGCAGCCAATCTGAAAGGATATTCTCGAGAATATCCTTTCAGATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009419.3-1532s21c1
Sequence:CCGGCGCTTCAGAAACTTGGAGATTCTCGAGAATCTCCAAGTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-1246s21c1
Sequence:CCGGCGGGTCTTGAAAGGAGACTATCTCGAGATAGTCTCCTTTCAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-1274s21c1
Sequence:CCGGCAGCCAATCTGAAAGGATATTCTCGAGAATATCCTTTCAGATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009419.3-727s21c1
Sequence:CCGGCCCAACTCCAAATTCCTGCTACTCGAGTAGCAGGAATTTGGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003595
VALIDATED
TPST2 MISSION shRNA Bacterial Glycerol Stock
tyrosylprotein sulfotransferase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-1283s1c1
Sequence:CCGGCCAGCCAATCTGAAAGGATATCTCGAGATATCCTTTCAGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003595.2-680s1c1
Sequence:CCGGCTCTGCAACAAGGACCCATTTCTCGAGAAATGGGTCCTTGTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003595.2-739s1c1
Sequence:CCGGCAACTCCAAGTTCCTGCTGATCTCGAGATCAGCAGGAACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-394s1c1
Sequence:CCGGCGTGGAATACCGCTATGGCAACTCGAGTTGCCATAGCGGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-1010s1c1
Sequence:CCGGCTCCACCATGAAGACCTCATTCTCGAGAATGAGGTCTTCATGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-755s21c1
Sequence:CCGGCAACTCCAAGTTCCTGCTGATCTCGAGATCAGCAGGAACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-696s21c1
Sequence:CCGGCTCTGCAACAAGGACCCATTTCTCGAGAAATGGGTCCTTGTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-1299s21c1
Sequence:CCGGCCAGCCAATCTGAAAGGATATCTCGAGATATCCTTTCAGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-1026s21c1
Sequence:CCGGCTCCACCATGAAGACCTCATTCTCGAGAATGAGGTCTTCATGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003595
VALIDATED
TPST2 MISSION shRNA shRNA Plasmid DNA
tyrosylprotein sulfotransferase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-1283s1c1
Sequence:CCGGCCAGCCAATCTGAAAGGATATCTCGAGATATCCTTTCAGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003595.2-680s1c1
Sequence:CCGGCTCTGCAACAAGGACCCATTTCTCGAGAAATGGGTCCTTGTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003595.2-739s1c1
Sequence:CCGGCAACTCCAAGTTCCTGCTGATCTCGAGATCAGCAGGAACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-394s1c1
Sequence:CCGGCGTGGAATACCGCTATGGCAACTCGAGTTGCCATAGCGGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-1010s1c1
Sequence:CCGGCTCCACCATGAAGACCTCATTCTCGAGAATGAGGTCTTCATGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-755s21c1
Sequence:CCGGCAACTCCAAGTTCCTGCTGATCTCGAGATCAGCAGGAACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-696s21c1
Sequence:CCGGCTCTGCAACAAGGACCCATTTCTCGAGAAATGGGTCCTTGTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-1299s21c1
Sequence:CCGGCCAGCCAATCTGAAAGGATATCTCGAGATATCCTTTCAGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-1026s21c1
Sequence:CCGGCTCCACCATGAAGACCTCATTCTCGAGAATGAGGTCTTCATGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003595
VALIDATED
TPST2 MISSION shRNA Lentiviral Transduction Particles
tyrosylprotein sulfotransferase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-1283s1c1
Sequence:CCGGCCAGCCAATCTGAAAGGATATCTCGAGATATCCTTTCAGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003595.2-680s1c1
Sequence:CCGGCTCTGCAACAAGGACCCATTTCTCGAGAAATGGGTCCTTGTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003595.2-739s1c1
Sequence:CCGGCAACTCCAAGTTCCTGCTGATCTCGAGATCAGCAGGAACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-394s1c1
Sequence:CCGGCGTGGAATACCGCTATGGCAACTCGAGTTGCCATAGCGGTATTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_003595.2-1010s1c1
Sequence:CCGGCTCCACCATGAAGACCTCATTCTCGAGAATGAGGTCTTCATGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-755s21c1
Sequence:CCGGCAACTCCAAGTTCCTGCTGATCTCGAGATCAGCAGGAACTTGGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-696s21c1
Sequence:CCGGCTCTGCAACAAGGACCCATTTCTCGAGAAATGGGTCCTTGTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-1299s21c1
Sequence:CCGGCCAGCCAATCTGAAAGGATATCTCGAGATATCCTTTCAGATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003595.3-1026s21c1
Sequence:CCGGCTCCACCATGAAGACCTCATTCTCGAGAATGAGGTCTTCATGGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks