EMAIL THIS PAGE TO A FRIEND

TPT1

tumor protein, translationally-controlled 1

Synonyms: HRF TCTP p02
UniProtKB ID: P13693, B2R7E5, Q6YLS2, Q7Z4J4, Q96EE2, Q9UC70
Gene ID:
Mouse(22070) tumor protein, translationally-controlled 1
Rat(116646) tumor protein, translationally-controlled 1
Zebrafish(30723) tumor protein, translationally-controlled 1
chicken(396363) tumor protein, translationally-controlled 1
domestic cat(101083564) tumor protein, translationally-controlled 1
dog(476924) tumor protein, translationally-controlled 1
domestic guinea pig(100307058) tumor protein, translationally-controlled 1
naked mole-rat(101715542) tumor protein, translationally-controlled 1
Domestic Rabbit(100008854) tumor protein, translationally-controlled 1
cow(326599) tumor protein, translationally-controlled 1
Goat(100861285) tumor protein, translationally-controlled 1
sheep(100135455) tumor protein, translationally-controlled 1
Gene Class: Apoptosis
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003295 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003295 Rosetta Predictions human pricing
NM_053867 Rosetta Predictions rat pricing
NM_009429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335379 predicted 388
2 SASI_Hs02_00335380 predicted 204
3 SASI_Hs02_00335381 predicted 378
4 SASI_Hs02_00335382 predicted 522
5 SASI_Hs02_00335383 predicted 320
6 SASI_Hs02_00335384 predicted 322
7 SASI_Hs02_00335385 predicted 385
8 SASI_Hs02_00335386 predicted 117
9 SASI_Hs01_00063936 predicted 146
10 SASI_Hs01_00063937 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266745 predicted 279
2 SASI_Rn02_00266746 predicted 269
3 SASI_Rn02_00266747 predicted 207
4 SASI_Rn02_00266748 predicted 257
5 SASI_Rn02_00266749 predicted 444
6 SASI_Rn02_00266750 predicted 354
7 SASI_Rn02_00266751 predicted 196
8 SASI_Rn02_00266752 predicted 419
9 SASI_Rn02_00266753 predicted 491
10 SASI_Rn02_00266754 predicted 423
11 SASI_Rn01_00114806 predicted 597
12 SASI_Rn01_00114807 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316108 predicted 274
2 SASI_Mm02_00316109 predicted 314
3 SASI_Mm02_00316110 predicted 450
4 SASI_Mm02_00316111 predicted 389
5 SASI_Mm02_00316112 predicted 285
6 SASI_Mm02_00316113 predicted 439
7 SASI_Mm02_00316114 predicted 380
8 SASI_Mm02_00316115 predicted 400
9 SASI_Mm02_00316116 predicted 446
10 SASI_Mm02_00316117 predicted 402
11 SASI_Mm01_00112829 predicted 679
12 SASI_Mm01_00112830 predicted 633
13 SASI_Mm01_00112831 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003295
VALIDATED
TPT1 MISSION shRNA Bacterial Glycerol Stock
tumor protein, translationally-controlled 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003295.2-780s21c1
Sequence:CCGGATGTCATGTAGGTTGTCTAAACTCGAGTTTAGACAACCTACATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003295.2-227s21c1
Sequence:CCGGACTCGCTCATTGGTGGAAATGCTCGAGCATTTCCACCAATGAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-328s1c1
Sequence:CCGGGCAGGAAACAAGTTTCACAAACTCGAGTTTGTGAAACTTGTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-463s1c1
Sequence:CCGGGCACATCCTTGCTAATTTCAACTCGAGTTGAAATTAGCAAGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003295.1-379s1c1
Sequence:CCGGCATGAAATCAATCAAAGGGAACTCGAGTTCCCTTTGATTGATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-536s1c1
Sequence:CCGGCTATTGGACTACCGTGAGGATCTCGAGATCCTCACGGTAGTCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003295
VALIDATED
TPT1 MISSION shRNA shRNA Plasmid DNA
tumor protein, translationally-controlled 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003295.2-780s21c1
Sequence:CCGGATGTCATGTAGGTTGTCTAAACTCGAGTTTAGACAACCTACATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003295.2-227s21c1
Sequence:CCGGACTCGCTCATTGGTGGAAATGCTCGAGCATTTCCACCAATGAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-328s1c1
Sequence:CCGGGCAGGAAACAAGTTTCACAAACTCGAGTTTGTGAAACTTGTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-463s1c1
Sequence:CCGGGCACATCCTTGCTAATTTCAACTCGAGTTGAAATTAGCAAGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003295.1-379s1c1
Sequence:CCGGCATGAAATCAATCAAAGGGAACTCGAGTTCCCTTTGATTGATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-536s1c1
Sequence:CCGGCTATTGGACTACCGTGAGGATCTCGAGATCCTCACGGTAGTCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003295
VALIDATED
TPT1 MISSION shRNA Lentiviral Transduction Particles
tumor protein, translationally-controlled 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003295.2-780s21c1
Sequence:CCGGATGTCATGTAGGTTGTCTAAACTCGAGTTTAGACAACCTACATGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003295.2-227s21c1
Sequence:CCGGACTCGCTCATTGGTGGAAATGCTCGAGCATTTCCACCAATGAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-328s1c1
Sequence:CCGGGCAGGAAACAAGTTTCACAAACTCGAGTTTGTGAAACTTGTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-463s1c1
Sequence:CCGGGCACATCCTTGCTAATTTCAACTCGAGTTGAAATTAGCAAGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003295.1-379s1c1
Sequence:CCGGCATGAAATCAATCAAAGGGAACTCGAGTTCCCTTTGATTGATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003295.1-536s1c1
Sequence:CCGGCTATTGGACTACCGTGAGGATCTCGAGATCCTCACGGTAGTCCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009429
TPT1 MISSION shRNA Bacterial Glycerol Stock
tumor protein, translationally-controlled 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009429.2-447s21c1
Sequence:CCGGGGAGCTGCAGAGCAGATTAAGCTCGAGCTTAATCTGCTCTGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009429.2-231s21c1
Sequence:CCGGGACTCGCTCATCGGTGGAAATCTCGAGATTTCCACCGATGAGCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009429.2-629s21c1
Sequence:CCGGTATCACCTGTCAACCATAATTCTCGAGAATTATGGTTGACAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009429.2-666s1c1
Sequence:CCGGCCATACAACACCAGGACTTTACTCGAGTAAAGTCCTGGTGTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-378s1c1
Sequence:CCGGGACTACATGAAATCACTCAAACTCGAGTTTGAGTGATTTCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-302s1c1
Sequence:CCGGCGGTGTTGACATTGTCATGAACTCGAGTTCATGACAATGTCAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-456s1c1
Sequence:CCGGGAGCAGATTAAGCACATCCTTCTCGAGAAGGATGTGCTTAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-591s1c1
Sequence:CCGGGATGGCTTAGAGATGGAGAAACTCGAGTTTCTCCATCTCTAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009429
TPT1 MISSION shRNA shRNA Plasmid DNA
tumor protein, translationally-controlled 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009429.2-447s21c1
Sequence:CCGGGGAGCTGCAGAGCAGATTAAGCTCGAGCTTAATCTGCTCTGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009429.2-231s21c1
Sequence:CCGGGACTCGCTCATCGGTGGAAATCTCGAGATTTCCACCGATGAGCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009429.2-629s21c1
Sequence:CCGGTATCACCTGTCAACCATAATTCTCGAGAATTATGGTTGACAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009429.2-666s1c1
Sequence:CCGGCCATACAACACCAGGACTTTACTCGAGTAAAGTCCTGGTGTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-378s1c1
Sequence:CCGGGACTACATGAAATCACTCAAACTCGAGTTTGAGTGATTTCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-302s1c1
Sequence:CCGGCGGTGTTGACATTGTCATGAACTCGAGTTCATGACAATGTCAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-456s1c1
Sequence:CCGGGAGCAGATTAAGCACATCCTTCTCGAGAAGGATGTGCTTAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-591s1c1
Sequence:CCGGGATGGCTTAGAGATGGAGAAACTCGAGTTTCTCCATCTCTAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009429
TPT1 MISSION shRNA Lentiviral Transduction Particles
tumor protein, translationally-controlled 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009429.2-447s21c1
Sequence:CCGGGGAGCTGCAGAGCAGATTAAGCTCGAGCTTAATCTGCTCTGCAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009429.2-231s21c1
Sequence:CCGGGACTCGCTCATCGGTGGAAATCTCGAGATTTCCACCGATGAGCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009429.2-629s21c1
Sequence:CCGGTATCACCTGTCAACCATAATTCTCGAGAATTATGGTTGACAGGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009429.2-666s1c1
Sequence:CCGGCCATACAACACCAGGACTTTACTCGAGTAAAGTCCTGGTGTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-378s1c1
Sequence:CCGGGACTACATGAAATCACTCAAACTCGAGTTTGAGTGATTTCATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-302s1c1
Sequence:CCGGCGGTGTTGACATTGTCATGAACTCGAGTTCATGACAATGTCAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-456s1c1
Sequence:CCGGGAGCAGATTAAGCACATCCTTCTCGAGAAGGATGTGCTTAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009429.2-591s1c1
Sequence:CCGGGATGGCTTAGAGATGGAGAAACTCGAGTTTCTCCATCTCTAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks