EMAIL THIS PAGE TO A FRIEND

TPTE2

transmembrane phosphoinositide 3-phosphatase and tensin homolog 2

Synonyms: TPIP
Gene ID:
Human(93492) Summary: TPIP is a member of a large class of membrane-associated phosphatases with substrate specificity for the 3-position phosphate of inositol phospholipids.[supplied by OMIM, Jul 2002]
Rat(364629) transmembrane phosphoinositide 3-phosphatase and tensin homolog 2
domestic guinea pig(100721187) transmembrane phosphoinositide 3-phosphatase and tensin homolog 2
chicken(418885) transmembrane phosphoinositide 3-phosphatase and tensin homolog 2
dog(606856) transmembrane phosphoinositide 3-phosphatase and tensin homolog 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130785 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116181 MISSION® esiRNA esiRNA human AL137058.8-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130785 Rosetta Predictions human pricing
NM_199254 Rosetta Predictions human pricing
NM_199255 Rosetta Predictions human pricing
NM_001108877 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233970 predicted 1293
2 SASI_Hs01_00233969 predicted 1273
3 SASI_Hs01_00233964 predicted 956
4 SASI_Hs01_00233965 predicted 1030
5 SASI_Hs01_00233966 predicted 810
6 SASI_Hs01_00233967 predicted 827
7 SASI_Hs01_00233968 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220446 predicted 1518
2 SASI_Hs01_00220445 predicted 1499
3 SASI_Hs01_00220440 predicted 1192
4 SASI_Hs01_00220441 predicted 1259
5 SASI_Hs01_00220442 predicted 1038
6 SASI_Hs01_00220443 predicted 1051
7 SASI_Hs01_00220444 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186387 predicted 805
2 SASI_Hs01_00186388 predicted 871
3 SASI_Hs01_00186389 predicted 651
4 SASI_Hs01_00186390 predicted 657
5 SASI_Hs01_00186391 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242965 predicted 553
2 SASI_Rn02_00242966 predicted 2156
3 SASI_Rn02_00242967 predicted 963
4 SASI_Rn02_00242968 predicted 595
5 SASI_Rn02_00242969 predicted 737
6 SASI_Rn02_00242970 predicted 756
7 SASI_Rn02_00242971 predicted 2177
8 SASI_Rn02_00242972 predicted 2284
9 SASI_Rn02_00242973 predicted 1803
10 SASI_Rn02_00242974 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130785
TPTE2 MISSION shRNA Bacterial Glycerol Stock
transmembrane phosphoinositide 3-phosphatase and tensin homolog 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1192s21c1
Sequence:CCGGTTCGATTCGTGGTGATGTATGCTCGAGCATACATCACCACGAATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1266s21c1
Sequence:CCGGCATTAGGAAATTGTTCGATATCTCGAGATATCGAACAATTTCCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1031s21c1
Sequence:CCGGTTTGGAGAAAGGCGAACCAATCTCGAGATTGGTTCGCCTTTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-701s21c1
Sequence:CCGGTTCTATAGAAATCCAATTGAGCTCGAGCTCAATTGGATTTCTATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-716s1c1
Sequence:CCGGATTGAGGAAGTTGTGCGGTTTCTCGAGAAACCGCACAACTTCCTCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-477s1c1
Sequence:CCGGGAGTATTTGTAGAAGGATGGACTCGAGTCCATCCTTCTACAAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-1195s1c1
Sequence:CCGGGATTCGTGGTGATGTATGTGACTCGAGTCACATACATCACCACGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-948s1c1
Sequence:CCGGGCAAAGGAAGAACCGGGACTACTCGAGTAGTCCCGGTTCTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-949s1c1
Sequence:CCGGCAAAGGAAGAACCGGGACTATCTCGAGATAGTCCCGGTTCTTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130785
TPTE2 MISSION shRNA shRNA Plasmid DNA
transmembrane phosphoinositide 3-phosphatase and tensin homolog 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1192s21c1
Sequence:CCGGTTCGATTCGTGGTGATGTATGCTCGAGCATACATCACCACGAATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1266s21c1
Sequence:CCGGCATTAGGAAATTGTTCGATATCTCGAGATATCGAACAATTTCCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1031s21c1
Sequence:CCGGTTTGGAGAAAGGCGAACCAATCTCGAGATTGGTTCGCCTTTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-701s21c1
Sequence:CCGGTTCTATAGAAATCCAATTGAGCTCGAGCTCAATTGGATTTCTATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-716s1c1
Sequence:CCGGATTGAGGAAGTTGTGCGGTTTCTCGAGAAACCGCACAACTTCCTCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-477s1c1
Sequence:CCGGGAGTATTTGTAGAAGGATGGACTCGAGTCCATCCTTCTACAAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-1195s1c1
Sequence:CCGGGATTCGTGGTGATGTATGTGACTCGAGTCACATACATCACCACGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-948s1c1
Sequence:CCGGGCAAAGGAAGAACCGGGACTACTCGAGTAGTCCCGGTTCTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-949s1c1
Sequence:CCGGCAAAGGAAGAACCGGGACTATCTCGAGATAGTCCCGGTTCTTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130785
TPTE2 MISSION shRNA Lentiviral Transduction Particles
transmembrane phosphoinositide 3-phosphatase and tensin homolog 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1192s21c1
Sequence:CCGGTTCGATTCGTGGTGATGTATGCTCGAGCATACATCACCACGAATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1266s21c1
Sequence:CCGGCATTAGGAAATTGTTCGATATCTCGAGATATCGAACAATTTCCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-1031s21c1
Sequence:CCGGTTTGGAGAAAGGCGAACCAATCTCGAGATTGGTTCGCCTTTCTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130785.3-701s21c1
Sequence:CCGGTTCTATAGAAATCCAATTGAGCTCGAGCTCAATTGGATTTCTATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-716s1c1
Sequence:CCGGATTGAGGAAGTTGTGCGGTTTCTCGAGAAACCGCACAACTTCCTCAATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-477s1c1
Sequence:CCGGGAGTATTTGTAGAAGGATGGACTCGAGTCCATCCTTCTACAAATACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-1195s1c1
Sequence:CCGGGATTCGTGGTGATGTATGTGACTCGAGTCACATACATCACCACGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-948s1c1
Sequence:CCGGGCAAAGGAAGAACCGGGACTACTCGAGTAGTCCCGGTTCTTCCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130785.x-949s1c1
Sequence:CCGGCAAAGGAAGAACCGGGACTATCTCGAGATAGTCCCGGTTCTTCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks