EMAIL THIS PAGE TO A FRIEND

TPTE2P1

transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1

Species: Human TPTE2P1(646405)
UniProtKB ID: Q5T6R2, B3KST4, B4DMH9
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001126062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001126062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001126062 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126062 Rosetta Predictions human pricing
XM_929331 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328107 predicted 91
2 SASI_Hs02_00328108 predicted 479
3 SASI_Hs02_00328109 predicted 461
4 SASI_Hs02_00328110 predicted 225
5 SASI_Hs02_00328111 predicted 448
6 SASI_Hs02_00328112 predicted 477
7 SASI_Hs02_00328113 predicted 435
8 SASI_Hs02_00328114 predicted 468
9 SASI_Hs02_00328115 predicted 440
10 SASI_Hs02_00328116 predicted 128
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296174 predicted 154
2 SASI_Hs01_00296175 predicted 518
3 SASI_Hs01_00296176 predicted 277
4 SASI_Hs01_00296177 predicted 508
5 SASI_Hs01_00296178 predicted 487
6 SASI_Hs01_00296179 predicted 186
7 SASI_Hs01_00296180 predicted 529
8 SASI_Hs01_00296181 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126062
TPTE2P1 MISSION shRNA Bacterial Glycerol Stock
transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-226s21c1
Sequence:CCGGGGAACCTGGCTTACCAGTATACTCGAGTATACTGGTAAGCCAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-51s21c1
Sequence:CCGGTGCGTGGATCTCCAGTGGAAACTCGAGTTTCCACTGGAGATCCACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126062.1-297s21c1
Sequence:CCGGAGGTCAGCTCCTGGTCAATATCTCGAGATATTGACCAGGAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-122s21c1
Sequence:CCGGTTTAACTGCAGAGGCTTTATCCTCGAGGATAAAGCCTCTGCAGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126062
TPTE2P1 MISSION shRNA shRNA Plasmid DNA
transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-226s21c1
Sequence:CCGGGGAACCTGGCTTACCAGTATACTCGAGTATACTGGTAAGCCAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-51s21c1
Sequence:CCGGTGCGTGGATCTCCAGTGGAAACTCGAGTTTCCACTGGAGATCCACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126062.1-297s21c1
Sequence:CCGGAGGTCAGCTCCTGGTCAATATCTCGAGATATTGACCAGGAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-122s21c1
Sequence:CCGGTTTAACTGCAGAGGCTTTATCCTCGAGGATAAAGCCTCTGCAGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126062
TPTE2P1 MISSION shRNA Lentiviral Transduction Particles
transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-226s21c1
Sequence:CCGGGGAACCTGGCTTACCAGTATACTCGAGTATACTGGTAAGCCAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-51s21c1
Sequence:CCGGTGCGTGGATCTCCAGTGGAAACTCGAGTTTCCACTGGAGATCCACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001126062.1-297s21c1
Sequence:CCGGAGGTCAGCTCCTGGTCAATATCTCGAGATATTGACCAGGAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126062.1-122s21c1
Sequence:CCGGTTTAACTGCAGAGGCTTTATCCTCGAGGATAAAGCCTCTGCAGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks