EMAIL THIS PAGE TO A FRIEND

TPTE

transmembrane phosphatase with tensin homology

Synonyms: CT44 PTEN2
Species: Human TPTE(7179), Mouse Tpte(234129), Zebrafish tpte(327292)
Gene ID:
Mouse(234129) transmembrane phosphatase with tensin homology
Zebrafish(327292) transmembrane phosphatase with tensin homology
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013315 Rosetta Predictions human pricing
NM_199259 Rosetta Predictions human pricing
NM_199260 Rosetta Predictions human pricing
NM_199261 Rosetta Predictions human pricing
NM_199257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087718 predicted 1537
2 SASI_Hs01_00087719 predicted 1395
3 SASI_Hs01_00087720 predicted 1642
4 SASI_Hs01_00087721 predicted 1719
5 SASI_Hs01_00087722 predicted 1724
6 SASI_Hs01_00087723 predicted 1702
7 SASI_Hs01_00087724 predicted 1814
8 SASI_Hs01_00087725 predicted 1392
9 SASI_Hs01_00087726 predicted 2079
10 SASI_Hs01_00087727 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045623 predicted 1336
2 SASI_Hs01_00045624 predicted 1585
3 SASI_Hs01_00045625 predicted 1660
4 SASI_Hs01_00045626 predicted 1665
5 SASI_Hs01_00045627 predicted 1637
6 SASI_Hs01_00045628 predicted 1751
7 SASI_Hs01_00045622 predicted 1474
8 SASI_Hs01_00045629 predicted 1332
9 SASI_Hs01_00045630 predicted 2024
10 SASI_Hs01_00045631 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076100 predicted 1269
2 SASI_Hs01_00076101 predicted 1528
3 SASI_Hs01_00076102 predicted 1607
4 SASI_Hs01_00076103 predicted 1602
5 SASI_Hs01_00076104 predicted 1575
6 SASI_Hs01_00076105 predicted 1687
7 SASI_Hs01_00076099 predicted 1414
8 SASI_Hs01_00076106 predicted 1276
9 SASI_Hs01_00076107 predicted 1962
10 SASI_Hs01_00076108 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227400 predicted 1391
2 SASI_Hs01_00227401 predicted 1637
3 SASI_Hs01_00227402 predicted 1715
4 SASI_Hs01_00227403 predicted 1721
5 SASI_Hs01_00227404 predicted 1691
6 SASI_Hs01_00227405 predicted 1809
7 SASI_Hs01_00227399 predicted 1535
8 SASI_Hs01_00227406 predicted 1382
9 SASI_Hs01_00227407 predicted 2074
10 SASI_Hs01_00227408 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199865 predicted 547
2 SASI_Mm01_00199866 predicted 1422
3 SASI_Mm02_00351418 predicted 1632
4 SASI_Mm01_00199867 predicted 1041
5 SASI_Mm01_00199868 predicted 780
6 SASI_Mm01_00199869 predicted 804
7 SASI_Mm01_00199870 predicted 939
8 SASI_Mm01_00199872 predicted 2178
9 SASI_Mm02_00351419 predicted 1038
10 SASI_Mm01_00199873 predicted 1406
11 SASI_Mm01_00199871 predicted 2180
12 SASI_Mm01_00199874 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181851
TPTE MISSION shRNA Bacterial Glycerol Stock
transmembrane phosphatase with tensin homology
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-1014s1c1
Sequence:CCGGGCCTTCAGAATATTTGGAATTCTCGAGAATTCCAAATATTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-437s1c1
Sequence:CCGGGCCTGCAAATATTTACAAGATCTCGAGATCTTGTAAATATTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-2039s1c1
Sequence:CCGGCCTGGAAGTACAAATCATAATCTCGAGATTATGATTTGTACTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181851.3-2411s1c1
Sequence:CCGGCGAATTGGATAATACCCATAACTCGAGTTATGGGTATTATCCAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-1469s1c1
Sequence:CCGGGCGTATTATTGCCATGTCATTCTCGAGAATGACATGGCAATAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181851
TPTE MISSION shRNA shRNA Plasmid DNA
transmembrane phosphatase with tensin homology
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-1014s1c1
Sequence:CCGGGCCTTCAGAATATTTGGAATTCTCGAGAATTCCAAATATTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-437s1c1
Sequence:CCGGGCCTGCAAATATTTACAAGATCTCGAGATCTTGTAAATATTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-2039s1c1
Sequence:CCGGCCTGGAAGTACAAATCATAATCTCGAGATTATGATTTGTACTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181851.3-2411s1c1
Sequence:CCGGCGAATTGGATAATACCCATAACTCGAGTTATGGGTATTATCCAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-1469s1c1
Sequence:CCGGGCGTATTATTGCCATGTCATTCTCGAGAATGACATGGCAATAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181851
TPTE MISSION shRNA Lentiviral Transduction Particles
transmembrane phosphatase with tensin homology
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-1014s1c1
Sequence:CCGGGCCTTCAGAATATTTGGAATTCTCGAGAATTCCAAATATTCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-437s1c1
Sequence:CCGGGCCTGCAAATATTTACAAGATCTCGAGATCTTGTAAATATTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-2039s1c1
Sequence:CCGGCCTGGAAGTACAAATCATAATCTCGAGATTATGATTTGTACTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030119    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181851.3-2411s1c1
Sequence:CCGGCGAATTGGATAATACCCATAACTCGAGTTATGGGTATTATCCAATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181851.3-1469s1c1
Sequence:CCGGGCGTATTATTGCCATGTCATTCTCGAGAATGACATGGCAATAATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013315
TPTE MISSION shRNA Bacterial Glycerol Stock
transmembrane phosphatase with tensin homology
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050103    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-2071s1c1
Sequence:CCGGCTATCCTAAATGTTCCCTTGACTCGAGTCAAGGGAACATTTAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013315.2-1596s1c1
Sequence:CCGGCATTATTTATTCGATTCCTCGCTCGAGCGAGGAATCGAATAAATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050107    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-365s1c1
Sequence:CCGGACCTGGCGGGAGTCATCATTGCTCGAGCAATGATGACTCCCGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050105    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-1353s1c1
Sequence:CCGGTAAAGGAGGCACAGATAGAACCTCGAGGTTCTATCTGTGCCTCCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050104    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-1822s1c1
Sequence:CCGGTACTTCTGGTTGCACACATCTCTCGAGAGATGTGTGCAACCAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013315
TPTE MISSION shRNA shRNA Plasmid DNA
transmembrane phosphatase with tensin homology
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050103    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-2071s1c1
Sequence:CCGGCTATCCTAAATGTTCCCTTGACTCGAGTCAAGGGAACATTTAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013315.2-1596s1c1
Sequence:CCGGCATTATTTATTCGATTCCTCGCTCGAGCGAGGAATCGAATAAATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050107    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-365s1c1
Sequence:CCGGACCTGGCGGGAGTCATCATTGCTCGAGCAATGATGACTCCCGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050105    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-1353s1c1
Sequence:CCGGTAAAGGAGGCACAGATAGAACCTCGAGGTTCTATCTGTGCCTCCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050104    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-1822s1c1
Sequence:CCGGTACTTCTGGTTGCACACATCTCTCGAGAGATGTGTGCAACCAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013315
TPTE MISSION shRNA Lentiviral Transduction Particles
transmembrane phosphatase with tensin homology
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050103    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-2071s1c1
Sequence:CCGGCTATCCTAAATGTTCCCTTGACTCGAGTCAAGGGAACATTTAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013315.2-1596s1c1
Sequence:CCGGCATTATTTATTCGATTCCTCGCTCGAGCGAGGAATCGAATAAATAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050107    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-365s1c1
Sequence:CCGGACCTGGCGGGAGTCATCATTGCTCGAGCAATGATGACTCCCGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050105    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-1353s1c1
Sequence:CCGGTAAAGGAGGCACAGATAGAACCTCGAGGTTCTATCTGTGCCTCCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050104    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_013315.2-1822s1c1
Sequence:CCGGTACTTCTGGTTGCACACATCTCTCGAGAGATGTGTGCAACCAGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199257
TPTE MISSION shRNA Bacterial Glycerol Stock
transmembrane phosphatase with tensin homology
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000420155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199257.2-1178s21c1
Sequence:CCGGAGAAGGGAGACGGCGCTATTTCTCGAGAAATAGCGCCGTCTCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199257.2-1571s21c1
Sequence:CCGGCTATCAAGTCTACAATCTATGCTCGAGCATAGATTGTAGACTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199257
TPTE MISSION shRNA shRNA Plasmid DNA
transmembrane phosphatase with tensin homology
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000420155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199257.2-1178s21c1
Sequence:CCGGAGAAGGGAGACGGCGCTATTTCTCGAGAAATAGCGCCGTCTCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199257.2-1571s21c1
Sequence:CCGGCTATCAAGTCTACAATCTATGCTCGAGCATAGATTGTAGACTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199257
TPTE MISSION shRNA Lentiviral Transduction Particles
transmembrane phosphatase with tensin homology
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000420155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199257.2-1178s21c1
Sequence:CCGGAGAAGGGAGACGGCGCTATTTCTCGAGAAATAGCGCCGTCTCCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199257.2-1571s21c1
Sequence:CCGGCTATCAAGTCTACAATCTATGCTCGAGCATAGATTGTAGACTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199260
TPTE MISSION shRNA Bacterial Glycerol Stock
transmembrane phosphatase with tensin homology
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000355868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1529s21c1
Sequence:CCGGTCGTTATGTACGTGATCTAAACTCGAGTTTAGATCACGTACATAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1826s21c1
Sequence:CCGGGAGAATTTATCCATCAGATTTCTCGAGAAATCTGATGGATAAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1278s21c1
Sequence:CCGGACAGATAGAACAGGAACTATGCTCGAGCATAGTTCCTGTTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1606s21c1
Sequence:CCGGGTTCGGTACTTGATAACATTACTCGAGTAATGTTATCAAGTACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199260
TPTE MISSION shRNA shRNA Plasmid DNA
transmembrane phosphatase with tensin homology
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000355868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1529s21c1
Sequence:CCGGTCGTTATGTACGTGATCTAAACTCGAGTTTAGATCACGTACATAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1826s21c1
Sequence:CCGGGAGAATTTATCCATCAGATTTCTCGAGAAATCTGATGGATAAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1278s21c1
Sequence:CCGGACAGATAGAACAGGAACTATGCTCGAGCATAGTTCCTGTTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1606s21c1
Sequence:CCGGGTTCGGTACTTGATAACATTACTCGAGTAATGTTATCAAGTACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199260
TPTE MISSION shRNA Lentiviral Transduction Particles
transmembrane phosphatase with tensin homology
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000355868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1529s21c1
Sequence:CCGGTCGTTATGTACGTGATCTAAACTCGAGTTTAGATCACGTACATAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1826s21c1
Sequence:CCGGGAGAATTTATCCATCAGATTTCTCGAGAAATCTGATGGATAAATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1278s21c1
Sequence:CCGGACAGATAGAACAGGAACTATGCTCGAGCATAGTTCCTGTTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199260.2-1606s21c1
Sequence:CCGGGTTCGGTACTTGATAACATTACTCGAGTAATGTTATCAAGTACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks