EMAIL THIS PAGE TO A FRIEND

TPX2

TPX2, microtubule-associated

Synonyms: C20orf1 C20orf2 DIL-2 DIL2 FLS353 GD:C20orf1 HCA519 HCTP4 REPP86 p100
UniProtKB ID: Q9ULW0, Q9H1R4, Q9NRA3, Q9UFN9, Q9UL00, Q9Y2M1
Gene ID:
Mouse(72119) TPX2, microtubule-associated protein homolog (Xenopus laevis)
Rat(311546) TPX2, microtubule-associated
Thale Cress(839140) targeting protein for XKLP2
dog(477186) TPX2, microtubule-associated, homolog (Xenopus laevis)
Horse(100053648) TPX2, microtubule-associated, homolog (Xenopus laevis)
domestic cat(101096223) TPX2, microtubule-associated, homolog (Xenopus laevis)
chicken(395081) TPX2, microtubule-associated, homolog (Xenopus laevis)
Thale Cress(842909) thioredoxin-dependent peroxidase 2
domestic guinea pig(100727710) TPX2, microtubule-associated, homolog (Xenopus laevis)
Domestic Rabbit(100342435) TPX2, microtubule-associated, homolog (Xenopus laevis)
naked mole-rat(101712806) TPX2, microtubule-associated, homolog (Xenopus laevis)
cow(507226) TPX2, microtubule-associated, homolog (Xenopus laevis)
sheep(101102581) TPX2, microtubule-associated, homolog (Xenopus laevis)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012112 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012112 Rosetta Predictions human pricing
NM_001107790 Rosetta Predictions rat pricing
NM_028109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343640 predicted 3003
2 SASI_Hs01_00092218 predicted 896
3 SASI_Hs01_00092221 predicted 1399
4 SASI_Hs01_00092222 predicted 1596
5 SASI_Hs01_00092224 predicted 1218
6 SASI_Hs02_00343641 predicted 1123
7 SASI_Hs01_00092226 predicted 1579
8 SASI_Hs02_00343642 predicted 833
9 SASI_Hs02_00343643 predicted 808
10 SASI_Hs02_00343644 predicted 2930
11 SASI_Hs01_00092217 predicted 1547
12 SASI_Hs01_00092219 predicted 1747
13 SASI_Hs01_00092220 predicted 812
14 SASI_Hs01_00092223 predicted 2472
15 SASI_Hs01_00092225 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232295 predicted 1900
2 SASI_Rn02_00232296 predicted 1602
3 SASI_Rn02_00232297 predicted 1696
4 SASI_Rn02_00232298 predicted 1566
5 SASI_Rn02_00232299 predicted 2253
6 SASI_Rn02_00232300 predicted 2636
7 SASI_Rn02_00232301 predicted 619
8 SASI_Rn02_00232302 predicted 1292
9 SASI_Rn02_00232303 predicted 1731
10 SASI_Rn02_00232304 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130092 predicted 2690
2 SASI_Mm01_00130093 predicted 1709
3 SASI_Mm01_00130096 predicted 1307
4 SASI_Mm01_00130097 predicted 2637
5 SASI_Mm02_00333352 predicted 1664
6 SASI_Mm02_00333353 predicted 618
7 SASI_Mm01_00130099 predicted 1650
8 SASI_Mm01_00130100 predicted 758
9 SASI_Mm01_00130101 predicted 1163
10 SASI_Mm02_00333354 predicted 1375
11 SASI_Mm01_00130094 predicted 1425
12 SASI_Mm01_00130095 predicted 668
13 SASI_Mm01_00130098 predicted 1374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028109
VALIDATED
TPX2 MISSION shRNA Bacterial Glycerol Stock
TPX2, microtubule-associated
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-2878s21c1
Sequence:CCGGCCAGACTTCTTGTAGTTATTTCTCGAGAAATAACTACAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-2717s21c1
Sequence:CCGGCAGTAGAAGCTGCATCTATATCTCGAGATATAGATGCAGCTTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1663s21c1
Sequence:CCGGGCTTGAGAAACTGCAACAATACTCGAGTATTGTTGCAGTTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1592s21c1
Sequence:CCGGCCCATACTGCAGACCAAATATCTCGAGATATTTGGTCTGCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1859s21c1
Sequence:CCGGTCTAGACCTTGTCCTACTAAGCTCGAGCTTAGTAGGACAAGGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-2779s1c1
Sequence:CCGGCCAGACTTCTTGTAGTTATTTCTCGAGAAATAACTACAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028109.2-1598s1c1
Sequence:CCGGCGGGAACTTGATCCTAGAATTCTCGAGAATTCTAGGATCAAGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1919s1c1
Sequence:CCGGGCTCAACCTGTGCCACATTATCTCGAGATAATGTGGCACAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1439s1c1
Sequence:CCGGGAGAGCTTGTTACCCTCCAAACTCGAGTTTGGAGGGTAACAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1177s1c1
Sequence:CCGGCCTCACAGATGAGCGAATCAACTCGAGTTGATTCGCTCATCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028109
VALIDATED
TPX2 MISSION shRNA shRNA Plasmid DNA
TPX2, microtubule-associated
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-2878s21c1
Sequence:CCGGCCAGACTTCTTGTAGTTATTTCTCGAGAAATAACTACAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-2717s21c1
Sequence:CCGGCAGTAGAAGCTGCATCTATATCTCGAGATATAGATGCAGCTTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1663s21c1
Sequence:CCGGGCTTGAGAAACTGCAACAATACTCGAGTATTGTTGCAGTTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1592s21c1
Sequence:CCGGCCCATACTGCAGACCAAATATCTCGAGATATTTGGTCTGCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1859s21c1
Sequence:CCGGTCTAGACCTTGTCCTACTAAGCTCGAGCTTAGTAGGACAAGGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-2779s1c1
Sequence:CCGGCCAGACTTCTTGTAGTTATTTCTCGAGAAATAACTACAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028109.2-1598s1c1
Sequence:CCGGCGGGAACTTGATCCTAGAATTCTCGAGAATTCTAGGATCAAGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1919s1c1
Sequence:CCGGGCTCAACCTGTGCCACATTATCTCGAGATAATGTGGCACAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1439s1c1
Sequence:CCGGGAGAGCTTGTTACCCTCCAAACTCGAGTTTGGAGGGTAACAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1177s1c1
Sequence:CCGGCCTCACAGATGAGCGAATCAACTCGAGTTGATTCGCTCATCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028109
VALIDATED
TPX2 MISSION shRNA Lentiviral Transduction Particles
TPX2, microtubule-associated
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-2878s21c1
Sequence:CCGGCCAGACTTCTTGTAGTTATTTCTCGAGAAATAACTACAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-2717s21c1
Sequence:CCGGCAGTAGAAGCTGCATCTATATCTCGAGATATAGATGCAGCTTCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1663s21c1
Sequence:CCGGGCTTGAGAAACTGCAACAATACTCGAGTATTGTTGCAGTTTCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1592s21c1
Sequence:CCGGCCCATACTGCAGACCAAATATCTCGAGATATTTGGTCTGCAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028109.4-1859s21c1
Sequence:CCGGTCTAGACCTTGTCCTACTAAGCTCGAGCTTAGTAGGACAAGGTCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-2779s1c1
Sequence:CCGGCCAGACTTCTTGTAGTTATTTCTCGAGAAATAACTACAAGAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028109.2-1598s1c1
Sequence:CCGGCGGGAACTTGATCCTAGAATTCTCGAGAATTCTAGGATCAAGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1919s1c1
Sequence:CCGGGCTCAACCTGTGCCACATTATCTCGAGATAATGTGGCACAGGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1439s1c1
Sequence:CCGGGAGAGCTTGTTACCCTCCAAACTCGAGTTTGGAGGGTAACAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028109.2-1177s1c1
Sequence:CCGGCCTCACAGATGAGCGAATCAACTCGAGTTGATTCGCTCATCTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012112
VALIDATED
TPX2 MISSION shRNA Bacterial Glycerol Stock
TPX2, microtubule-associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-889s21c1
Sequence:CCGGCTAATCTTCAGCAAGCTATTGCTCGAGCAATAGCTTGCTGAAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-1139s21c1
Sequence:CCGGTCCTGTAATCATCGATGAAATCTCGAGATTTCATCGATGATTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-3424s21c1
Sequence:CCGGTACCGTGAATTTATAGTTAAGCTCGAGCTTAACTATAAATTCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-972s21c1
Sequence:CCGGGAACAATCCATTCCGTCAAATCTCGAGATTTGACGGAATGGATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-2073s21c1
Sequence:CCGGTCCAGACCTTGCCCTACTAAGCTCGAGCTTAGTAGGGCAAGGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012112.4-3177s1c1
Sequence:CCGGCCATGTAGTTACTTCCTTTAACTCGAGTTAAAGGAAGTAACTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1911s1c1
Sequence:CCGGCGTGAACTTGATCCCAGAATACTCGAGTATTCTGGGATCAAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-876s1c1
Sequence:CCGGCCTTTGAGAAAGGCTAATCTTCTCGAGAAGATTAGCCTTTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1981s1c1
Sequence:CCGGCCGAGCCTATTGGCTTTGATTCTCGAGAATCAAAGCCAATAGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1982s1c1
Sequence:CCGGCGAGCCTATTGGCTTTGATTTCTCGAGAAATCAAAGCCAATAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012112
VALIDATED
TPX2 MISSION shRNA shRNA Plasmid DNA
TPX2, microtubule-associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-889s21c1
Sequence:CCGGCTAATCTTCAGCAAGCTATTGCTCGAGCAATAGCTTGCTGAAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-1139s21c1
Sequence:CCGGTCCTGTAATCATCGATGAAATCTCGAGATTTCATCGATGATTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-3424s21c1
Sequence:CCGGTACCGTGAATTTATAGTTAAGCTCGAGCTTAACTATAAATTCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-972s21c1
Sequence:CCGGGAACAATCCATTCCGTCAAATCTCGAGATTTGACGGAATGGATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-2073s21c1
Sequence:CCGGTCCAGACCTTGCCCTACTAAGCTCGAGCTTAGTAGGGCAAGGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012112.4-3177s1c1
Sequence:CCGGCCATGTAGTTACTTCCTTTAACTCGAGTTAAAGGAAGTAACTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1911s1c1
Sequence:CCGGCGTGAACTTGATCCCAGAATACTCGAGTATTCTGGGATCAAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-876s1c1
Sequence:CCGGCCTTTGAGAAAGGCTAATCTTCTCGAGAAGATTAGCCTTTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1981s1c1
Sequence:CCGGCCGAGCCTATTGGCTTTGATTCTCGAGAATCAAAGCCAATAGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1982s1c1
Sequence:CCGGCGAGCCTATTGGCTTTGATTTCTCGAGAAATCAAAGCCAATAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012112
VALIDATED
TPX2 MISSION shRNA Lentiviral Transduction Particles
TPX2, microtubule-associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-889s21c1
Sequence:CCGGCTAATCTTCAGCAAGCTATTGCTCGAGCAATAGCTTGCTGAAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-1139s21c1
Sequence:CCGGTCCTGTAATCATCGATGAAATCTCGAGATTTCATCGATGATTACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-3424s21c1
Sequence:CCGGTACCGTGAATTTATAGTTAAGCTCGAGCTTAACTATAAATTCACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-972s21c1
Sequence:CCGGGAACAATCCATTCCGTCAAATCTCGAGATTTGACGGAATGGATTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012112.4-2073s21c1
Sequence:CCGGTCCAGACCTTGCCCTACTAAGCTCGAGCTTAGTAGGGCAAGGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012112.4-3177s1c1
Sequence:CCGGCCATGTAGTTACTTCCTTTAACTCGAGTTAAAGGAAGTAACTACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1911s1c1
Sequence:CCGGCGTGAACTTGATCCCAGAATACTCGAGTATTCTGGGATCAAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-876s1c1
Sequence:CCGGCCTTTGAGAAAGGCTAATCTTCTCGAGAAGATTAGCCTTTCTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1981s1c1
Sequence:CCGGCCGAGCCTATTGGCTTTGATTCTCGAGAATCAAAGCCAATAGGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012112.4-1982s1c1
Sequence:CCGGCGAGCCTATTGGCTTTGATTTCTCGAGAAATCAAAGCCAATAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks