EMAIL THIS PAGE TO A FRIEND

TRA2A

transformer 2 alpha homolog (Drosophila)

Synonyms: AWMS1 HSU53209
UniProtKB ID: Q13595
Gene ID:
Human(29896) Summary: This gene is a member of the transformer 2 homolog family and encodes a protein with two RS domains and an RRM (RNA recognition motif) domain. This phosphorylated nuclear protein binds to specific RNA sequences and plays a role in the regulation of pre-mRNA splicing. Several alternatively spliced transcript variants of this gene have been described; however, the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(101214) transformer 2 alpha homolog (Drosophila)
Rat(500116) transformer 2 alpha homolog (Drosophila)
Zebrafish(393388) transformer-2 alpha
domestic cat(101091270) transformer 2 alpha homolog (Drosophila)
chicken(420618) transformer 2 alpha homolog (Drosophila)
dog(482358) transformer 2 alpha homolog (Drosophila)
cow(534586) transformer 2 alpha homolog (Drosophila)
sheep(100171398) transformer 2 alpha homolog (Drosophila)
naked mole-rat(101724725) transformer 2 alpha homolog (Drosophila)
domestic guinea pig(100735453) transformer 2 alpha homolog (Drosophila)
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013293 Rosetta Predictions human pricing
NM_001126296 Rosetta Predictions rat pricing
XR_007448 Rosetta Predictions rat pricing
NM_198102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147012 predicted 274
2 SASI_Hs01_00147013 predicted 453
3 SASI_Hs01_00147014 predicted 346
4 SASI_Hs01_00147015 predicted 391
5 SASI_Hs01_00147017 predicted 565
6 SASI_Hs01_00147018 predicted 340
7 SASI_Hs01_00147019 predicted 528
8 SASI_Hs01_00147020 predicted 382
9 SASI_Hs02_00344571 predicted 608
10 SASI_Hs01_00147021 predicted 319
11 SASI_Hs01_00147016 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253333 predicted 234
2 SASI_Rn02_00253334 predicted 302
3 SASI_Rn02_00253335 predicted 346
4 SASI_Rn02_00253336 predicted 292
5 SASI_Rn02_00253337 predicted 548
6 SASI_Rn02_00253338 predicted 524
7 SASI_Rn02_00253339 predicted 1333
8 SASI_Rn02_00253340 predicted 410
9 SASI_Rn02_00253341 predicted 1341
10 SASI_Rn02_00253342 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135866 predicted 291
2 SASI_Rn01_00135867 predicted 363
3 SASI_Rn01_00135868 predicted 581
4 SASI_Rn01_00135869 predicted 418
5 SASI_Rn01_00135870 predicted 354
6 SASI_Rn01_00135871 predicted 609
7 SASI_Rn01_00135872 predicted 592
8 SASI_Rn01_00135873 predicted 480
9 SASI_Rn01_00135874 predicted 339
10 SASI_Rn01_00135875 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183796 predicted 1324
2 SASI_Mm01_00183797 predicted 1174
3 SASI_Mm02_00350823 predicted 1277
4 SASI_Mm01_00183799 predicted 1352
5 SASI_Mm01_00183800 predicted 1187
6 SASI_Mm01_00183802 predicted 1384
7 SASI_Mm01_00183803 predicted 1346
8 SASI_Mm01_00183804 predicted 1343
9 SASI_Mm02_00350824 predicted 1260
10 SASI_Mm01_00183805 predicted 298
11 SASI_Mm01_00183798 predicted 1078
12 SASI_Mm01_00183801 predicted 1238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013293
VALIDATED
TRA2A MISSION shRNA Bacterial Glycerol Stock
transformer 2 alpha homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013293.2-1245s1c1
Sequence:CCGGCCCAATGTTATGTTATGCTTTCTCGAGAAAGCATAACATAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013293.2-855s1c1
Sequence:CCGGCGTCGAGATTCTTACTATGATCTCGAGATCATAGTAAGAATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013293.2-399s1c1
Sequence:CCGGCGATCTCGAAGTAGATCATATCTCGAGATATGATCTACTTCGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013293.2-858s1c1
Sequence:CCGGCGAGATTCTTACTATGATAGACTCGAGTCTATCATAGTAAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_013293.2-400s1c1
Sequence:CCGGGATCTCGAAGTAGATCATATACTCGAGTATATGATCTACTTCGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-911s21c1
Sequence:CCGGCGTCGAGATTCTTACTATGATCTCGAGATCATAGTAAGAATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-1346s21c1
Sequence:CCGGTAGATAAACTTCTAGCTAATCCTCGAGGATTAGCTAGAAGTTTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-782s21c1
Sequence:CCGGATTCGGGTGGATTATTCTATACTCGAGTATAGAATAATCCACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013293.3-999s21c1
Sequence:CCGGCTCCTTATTATAGTCGATATACTCGAGTATATCGACTATAATAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013293.3-1062s21c1
Sequence:CCGGGATAACGGAATGGTTGCAATTCTCGAGAATTGCAACCATTCCGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013293
VALIDATED
TRA2A MISSION shRNA shRNA Plasmid DNA
transformer 2 alpha homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013293.2-1245s1c1
Sequence:CCGGCCCAATGTTATGTTATGCTTTCTCGAGAAAGCATAACATAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013293.2-855s1c1
Sequence:CCGGCGTCGAGATTCTTACTATGATCTCGAGATCATAGTAAGAATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013293.2-399s1c1
Sequence:CCGGCGATCTCGAAGTAGATCATATCTCGAGATATGATCTACTTCGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013293.2-858s1c1
Sequence:CCGGCGAGATTCTTACTATGATAGACTCGAGTCTATCATAGTAAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_013293.2-400s1c1
Sequence:CCGGGATCTCGAAGTAGATCATATACTCGAGTATATGATCTACTTCGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-911s21c1
Sequence:CCGGCGTCGAGATTCTTACTATGATCTCGAGATCATAGTAAGAATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-1346s21c1
Sequence:CCGGTAGATAAACTTCTAGCTAATCCTCGAGGATTAGCTAGAAGTTTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-782s21c1
Sequence:CCGGATTCGGGTGGATTATTCTATACTCGAGTATAGAATAATCCACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013293.3-999s21c1
Sequence:CCGGCTCCTTATTATAGTCGATATACTCGAGTATATCGACTATAATAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013293.3-1062s21c1
Sequence:CCGGGATAACGGAATGGTTGCAATTCTCGAGAATTGCAACCATTCCGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013293
VALIDATED
TRA2A MISSION shRNA Lentiviral Transduction Particles
transformer 2 alpha homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013293.2-1245s1c1
Sequence:CCGGCCCAATGTTATGTTATGCTTTCTCGAGAAAGCATAACATAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013293.2-855s1c1
Sequence:CCGGCGTCGAGATTCTTACTATGATCTCGAGATCATAGTAAGAATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013293.2-399s1c1
Sequence:CCGGCGATCTCGAAGTAGATCATATCTCGAGATATGATCTACTTCGAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013293.2-858s1c1
Sequence:CCGGCGAGATTCTTACTATGATAGACTCGAGTCTATCATAGTAAGAATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_013293.2-400s1c1
Sequence:CCGGGATCTCGAAGTAGATCATATACTCGAGTATATGATCTACTTCGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-911s21c1
Sequence:CCGGCGTCGAGATTCTTACTATGATCTCGAGATCATAGTAAGAATCTCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-1346s21c1
Sequence:CCGGTAGATAAACTTCTAGCTAATCCTCGAGGATTAGCTAGAAGTTTATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_013293.3-782s21c1
Sequence:CCGGATTCGGGTGGATTATTCTATACTCGAGTATAGAATAATCCACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013293.3-999s21c1
Sequence:CCGGCTCCTTATTATAGTCGATATACTCGAGTATATCGACTATAATAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013293.3-1062s21c1
Sequence:CCGGGATAACGGAATGGTTGCAATTCTCGAGAATTGCAACCATTCCGTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198102
VALIDATED
TRA2A MISSION shRNA Bacterial Glycerol Stock
transformer 2 alpha homolog (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-1127s1c1
Sequence:CCGGCCACCCTTTGTTATACTCTAACTCGAGTTAGAGTATAACAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-874s1c1
Sequence:CCGGGCTATGACAGATACGAAGATTCTCGAGAATCTTCGTATCTGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198102.1-870s1c1
Sequence:CCGGCGAGGCTATGACAGATACGAACTCGAGTTCGTATCTGTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-265s1c1
Sequence:CCGGCCAAACATTCTGAATCCCATTCTCGAGAATGGGATTCAGAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-281s1c1
Sequence:CCGGCCATTCTCGATCAAGATCAAACTCGAGTTTGATCTTGATCGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-913s21c1
Sequence:CCGGGCTATGACAGATACGAAGATTCTCGAGAATCTTCGTATCTGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-416s21c1
Sequence:CCGGATCTCGGAGTAGGTCCTATACCTCGAGGTATAGGACCTACTCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-323s21c1
Sequence:CCGGCCATTCTCGATCAAGATCAAACTCGAGTTTGATCTTGATCGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-526s21c1
Sequence:CCGGACACTTGCTTGGGAGTATTTGCTCGAGCAAATACTCCCAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198102
VALIDATED
TRA2A MISSION shRNA shRNA Plasmid DNA
transformer 2 alpha homolog (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-1127s1c1
Sequence:CCGGCCACCCTTTGTTATACTCTAACTCGAGTTAGAGTATAACAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-874s1c1
Sequence:CCGGGCTATGACAGATACGAAGATTCTCGAGAATCTTCGTATCTGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198102.1-870s1c1
Sequence:CCGGCGAGGCTATGACAGATACGAACTCGAGTTCGTATCTGTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-265s1c1
Sequence:CCGGCCAAACATTCTGAATCCCATTCTCGAGAATGGGATTCAGAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-281s1c1
Sequence:CCGGCCATTCTCGATCAAGATCAAACTCGAGTTTGATCTTGATCGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-913s21c1
Sequence:CCGGGCTATGACAGATACGAAGATTCTCGAGAATCTTCGTATCTGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-416s21c1
Sequence:CCGGATCTCGGAGTAGGTCCTATACCTCGAGGTATAGGACCTACTCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-323s21c1
Sequence:CCGGCCATTCTCGATCAAGATCAAACTCGAGTTTGATCTTGATCGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-526s21c1
Sequence:CCGGACACTTGCTTGGGAGTATTTGCTCGAGCAAATACTCCCAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198102
VALIDATED
TRA2A MISSION shRNA Lentiviral Transduction Particles
transformer 2 alpha homolog (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-1127s1c1
Sequence:CCGGCCACCCTTTGTTATACTCTAACTCGAGTTAGAGTATAACAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-874s1c1
Sequence:CCGGGCTATGACAGATACGAAGATTCTCGAGAATCTTCGTATCTGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198102.1-870s1c1
Sequence:CCGGCGAGGCTATGACAGATACGAACTCGAGTTCGTATCTGTCATAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-265s1c1
Sequence:CCGGCCAAACATTCTGAATCCCATTCTCGAGAATGGGATTCAGAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198102.1-281s1c1
Sequence:CCGGCCATTCTCGATCAAGATCAAACTCGAGTTTGATCTTGATCGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-913s21c1
Sequence:CCGGGCTATGACAGATACGAAGATTCTCGAGAATCTTCGTATCTGTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-416s21c1
Sequence:CCGGATCTCGGAGTAGGTCCTATACCTCGAGGTATAGGACCTACTCCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-323s21c1
Sequence:CCGGCCATTCTCGATCAAGATCAAACTCGAGTTTGATCTTGATCGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198102.2-526s21c1
Sequence:CCGGACACTTGCTTGGGAGTATTTGCTCGAGCAAATACTCCCAAGCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks