EMAIL THIS PAGE TO A FRIEND

TRA2B

transformer 2 beta homolog (Drosophila)

Synonyms: Htra2-beta SFRS10 SRFS10 TRA2-BETA TRAN2B
UniProtKB ID: P62995, B4DVK2, D3DNU3, O15449, Q15815, Q64283
Gene ID:
Human(6434) Summary: This gene encodes a nuclear protein which functions as sequence-specific serine/arginine splicing factor which plays a role in mRNA processing, splicing patterns, and gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(20462) transformer 2 beta homolog (Drosophila)
Rat(117259) transformer 2 beta homolog (Drosophila)
domestic guinea pig(100734100) transformer 2 beta homolog (Drosophila)
cow(615156) transformer 2 beta homolog (Drosophila)
sheep(101115669) transformer 2 beta homolog (Drosophila)
Zebrafish(394172) transformer 2 beta homolog (Drosophila)
domestic cat(101101659) transformer 2 beta homolog (Drosophila)
dog(478663) transformer 2 beta homolog (Drosophila)
chicken(395403) transformer 2 beta homolog (Drosophila)
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004593 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004593 Rosetta Predictions human pricing
NM_057119 Rosetta Predictions rat pricing
NM_009186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059118 predicted 469
2 SASI_Hs01_00059119 predicted 1243
3 SASI_Hs02_00337956 predicted 1289
4 SASI_Hs01_00059120 predicted 520
5 SASI_Hs01_00059121 predicted 1407
6 SASI_Hs01_00059122 predicted 1476
7 SASI_Hs01_00059123 predicted 527
8 SASI_Hs02_00337957 predicted 242
9 SASI_Hs01_00059124 predicted 1061
10 SASI_Hs01_00059127 predicted 382
11 SASI_Hs01_00059125 predicted 280
12 SASI_Hs01_00059126 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043817 predicted 1093
2 SASI_Rn01_00043819 predicted 394
3 SASI_Rn01_00043820 predicted 384
4 SASI_Rn02_00267054 predicted 1087
5 SASI_Rn01_00043821 predicted 530
6 SASI_Rn01_00043822 predicted 608
7 SASI_Rn01_00043823 predicted 290
8 SASI_Rn01_00043824 predicted 262
9 SASI_Rn01_00043825 predicted 498
10 SASI_Rn01_00043826 predicted 520
11 SASI_Rn01_00043818 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181655 predicted 832
2 SASI_Mm01_00181656 predicted 845
3 SASI_Mm01_00181658 predicted 694
4 SASI_Mm01_00181659 predicted 707
5 SASI_Mm01_00181660 predicted 581
6 SASI_Mm01_00181657 predicted 909
7 SASI_Mm01_00181661 predicted 512
8 SASI_Mm01_00181662 predicted 1121
9 SASI_Mm01_00181663 predicted 1090
10 SASI_Mm01_00181664 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004593
VALIDATED
TRA2B MISSION shRNA Bacterial Glycerol Stock
transformer 2 beta homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004593.2-1618s21c1
Sequence:CCGGCATGAAACATACCATACTTATCTCGAGATAAGTATGGTATGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-626s21c1
Sequence:CCGGACTGTTGTCTTGGAGTATTTGCTCGAGCAAATACTCCAAGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-1123s21c1
Sequence:CCGGTACTCACCTCGTCGCTATTAACTCGAGTTAATAGCGACGAGGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-708s21c1
Sequence:CCGGTGCCGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004593.2-526s21c1
Sequence:CCGGAGGTCTTACAGTCGAGATTATCTCGAGATAATCTCGACTGTAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004593.x-1625s1c1
Sequence:CCGGAGCAGGAAATACGAAGAGTTACTCGAGTAACTCTTCGTATTTCCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004593.x-553s1c1
Sequence:CCGGTGCCGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004593.x-720s1c1
Sequence:CCGGATACGCCAACACCAGGAATTTCTCGAGAAATTCCTGGTGTTGGCGTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004593.x-481s1c1
Sequence:CCGGTGGAGTATTTGGGCTGAGCTTCTCGAGAAGCTCAGCCCAAATACTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004593.x-641s1c1
Sequence:CCGGGAAGCTAAAGAACGTGCCAATCTCGAGATTGGCACGTTCTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004593
VALIDATED
TRA2B MISSION shRNA shRNA Plasmid DNA
transformer 2 beta homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004593.2-1618s21c1
Sequence:CCGGCATGAAACATACCATACTTATCTCGAGATAAGTATGGTATGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-626s21c1
Sequence:CCGGACTGTTGTCTTGGAGTATTTGCTCGAGCAAATACTCCAAGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-1123s21c1
Sequence:CCGGTACTCACCTCGTCGCTATTAACTCGAGTTAATAGCGACGAGGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-708s21c1
Sequence:CCGGTGCCGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004593.2-526s21c1
Sequence:CCGGAGGTCTTACAGTCGAGATTATCTCGAGATAATCTCGACTGTAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004593.x-1625s1c1
Sequence:CCGGAGCAGGAAATACGAAGAGTTACTCGAGTAACTCTTCGTATTTCCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004593.x-553s1c1
Sequence:CCGGTGCCGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004593.x-720s1c1
Sequence:CCGGATACGCCAACACCAGGAATTTCTCGAGAAATTCCTGGTGTTGGCGTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004593.x-481s1c1
Sequence:CCGGTGGAGTATTTGGGCTGAGCTTCTCGAGAAGCTCAGCCCAAATACTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004593.x-641s1c1
Sequence:CCGGGAAGCTAAAGAACGTGCCAATCTCGAGATTGGCACGTTCTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004593
VALIDATED
TRA2B MISSION shRNA Lentiviral Transduction Particles
transformer 2 beta homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004593.2-1618s21c1
Sequence:CCGGCATGAAACATACCATACTTATCTCGAGATAAGTATGGTATGTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-626s21c1
Sequence:CCGGACTGTTGTCTTGGAGTATTTGCTCGAGCAAATACTCCAAGACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-1123s21c1
Sequence:CCGGTACTCACCTCGTCGCTATTAACTCGAGTTAATAGCGACGAGGTGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004593.2-708s21c1
Sequence:CCGGTGCCGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004593.2-526s21c1
Sequence:CCGGAGGTCTTACAGTCGAGATTATCTCGAGATAATCTCGACTGTAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004593.x-1625s1c1
Sequence:CCGGAGCAGGAAATACGAAGAGTTACTCGAGTAACTCTTCGTATTTCCTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004593.x-553s1c1
Sequence:CCGGTGCCGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCGGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004593.x-720s1c1
Sequence:CCGGATACGCCAACACCAGGAATTTCTCGAGAAATTCCTGGTGTTGGCGTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004593.x-481s1c1
Sequence:CCGGTGGAGTATTTGGGCTGAGCTTCTCGAGAAGCTCAGCCCAAATACTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_004593.x-641s1c1
Sequence:CCGGGAAGCTAAAGAACGTGCCAATCTCGAGATTGGCACGTTCTTTAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009186
VALIDATED
TRA2B MISSION shRNA Bacterial Glycerol Stock
transformer 2 beta homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-839s21c1
Sequence:CCGGGTTATGATGACCGGGACTATTCTCGAGAATAGTCCCGGTCATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-585s21c1
Sequence:CCGGTGCTGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-369s21c1
Sequence:CCGGATCACGATCTCGCTCGCATAGCTCGAGCTATGCGAGCGAGATCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-781s21c1
Sequence:CCGGAGACCCACTTATGGCAGTTCTCTCGAGAGAACTGCCATAAGTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-1207s21c1
Sequence:CCGGCGGTGCTTTGTTCAAAGTTAACTCGAGTTAACTTTGAACAAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-1208s1c1
Sequence:CCGGCGGTGCTTTGTTCAAAGTTAACTCGAGTTAACTTTGAACAAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-712s1c1
Sequence:CCGGGCGTCGAATTAGAGTCGATTTCTCGAGAAATCGACTCTAATTCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009186.2-309s1c1
Sequence:CCGGCCAGGTCTGAATCTAGGTCTACTCGAGTAGACCTAGATTCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-554s1c1
Sequence:CCGGCTAAGAGAAGTGTTCTCTAAACTCGAGTTTAGAGAACACTTCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-840s1c1
Sequence:CCGGGTTATGATGACCGGGACTATTCTCGAGAATAGTCCCGGTCATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009186
VALIDATED
TRA2B MISSION shRNA shRNA Plasmid DNA
transformer 2 beta homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-839s21c1
Sequence:CCGGGTTATGATGACCGGGACTATTCTCGAGAATAGTCCCGGTCATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-585s21c1
Sequence:CCGGTGCTGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-369s21c1
Sequence:CCGGATCACGATCTCGCTCGCATAGCTCGAGCTATGCGAGCGAGATCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-781s21c1
Sequence:CCGGAGACCCACTTATGGCAGTTCTCTCGAGAGAACTGCCATAAGTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-1207s21c1
Sequence:CCGGCGGTGCTTTGTTCAAAGTTAACTCGAGTTAACTTTGAACAAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-1208s1c1
Sequence:CCGGCGGTGCTTTGTTCAAAGTTAACTCGAGTTAACTTTGAACAAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-712s1c1
Sequence:CCGGGCGTCGAATTAGAGTCGATTTCTCGAGAAATCGACTCTAATTCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009186.2-309s1c1
Sequence:CCGGCCAGGTCTGAATCTAGGTCTACTCGAGTAGACCTAGATTCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-554s1c1
Sequence:CCGGCTAAGAGAAGTGTTCTCTAAACTCGAGTTTAGAGAACACTTCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-840s1c1
Sequence:CCGGGTTATGATGACCGGGACTATTCTCGAGAATAGTCCCGGTCATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009186
VALIDATED
TRA2B MISSION shRNA Lentiviral Transduction Particles
transformer 2 beta homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-839s21c1
Sequence:CCGGGTTATGATGACCGGGACTATTCTCGAGAATAGTCCCGGTCATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-585s21c1
Sequence:CCGGTGCTGATGTGTCTATTGTATACTCGAGTATACAATAGACACATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-369s21c1
Sequence:CCGGATCACGATCTCGCTCGCATAGCTCGAGCTATGCGAGCGAGATCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-781s21c1
Sequence:CCGGAGACCCACTTATGGCAGTTCTCTCGAGAGAACTGCCATAAGTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009186.4-1207s21c1
Sequence:CCGGCGGTGCTTTGTTCAAAGTTAACTCGAGTTAACTTTGAACAAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-1208s1c1
Sequence:CCGGCGGTGCTTTGTTCAAAGTTAACTCGAGTTAACTTTGAACAAAGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-712s1c1
Sequence:CCGGGCGTCGAATTAGAGTCGATTTCTCGAGAAATCGACTCTAATTCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009186.2-309s1c1
Sequence:CCGGCCAGGTCTGAATCTAGGTCTACTCGAGTAGACCTAGATTCAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-554s1c1
Sequence:CCGGCTAAGAGAAGTGTTCTCTAAACTCGAGTTTAGAGAACACTTCTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009186.2-840s1c1
Sequence:CCGGGTTATGATGACCGGGACTATTCTCGAGAATAGTCCCGGTCATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks