EMAIL THIS PAGE TO A FRIEND

TRABD2A

TraB domain containing 2A

Synonyms: C2orf89 TIKI1
UniProtKB ID: Q86V40, B4DKK8, I6UMB9
Gene ID:
naked mole-rat(101700259) TraB domain containing 2A
chicken(427288) TraB domain containing 2A
dog(483086) TraB domain containing 2A
domestic cat(101089598) TraB domain containing 2A
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302188 ANTI-LOC129293 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080824 Rosetta Predictions human pricing
XM_059341 Rosetta Predictions human pricing
XM_934847 Rosetta Predictions human pricing
XM_934849 Rosetta Predictions human pricing
XM_934852 Rosetta Predictions human pricing
XM_934854 Rosetta Predictions human pricing
XM_934855 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316013 predicted 731
2 SASI_Hs02_00316014 predicted 474
3 SASI_Hs02_00316015 predicted 237
4 SASI_Hs02_00316016 predicted 930
5 SASI_Hs02_00316017 predicted 934
6 SASI_Hs02_00316018 predicted 726
7 SASI_Hs02_00316019 predicted 1268
8 SASI_Hs02_00316020 predicted 1088
9 SASI_Hs02_00316021 predicted 843
10 SASI_Hs02_00316022 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273515 predicted 690
2 SASI_Hs01_00273516 predicted 444
3 SASI_Hs01_00273517 predicted 204
4 SASI_Hs01_00273518 predicted 1035
5 SASI_Hs01_00273519 predicted 1037
6 SASI_Hs01_00273520 predicted 686
7 SASI_Hs01_00273521 predicted 1380
8 SASI_Hs01_00273522 predicted 1194
9 SASI_Hs01_00273523 predicted 955
10 SASI_Hs01_00273524 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285280 predicted 465
2 SASI_Hs01_00285281 predicted 233
3 SASI_Hs01_00285282 predicted 520
4 SASI_Hs01_00285283 predicted 227
5 SASI_Hs01_00285284 predicted 324
6 SASI_Hs01_00285285 predicted 271
7 SASI_Hs01_00285286 predicted 396
8 SASI_Hs01_00285287 predicted 259
9 SASI_Hs01_00285288 predicted 241
10 SASI_Hs01_00285289 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272939 predicted 633
2 SASI_Hs01_00272940 predicted 626
3 SASI_Hs01_00272941 predicted 529
4 SASI_Hs01_00272942 predicted 599
5 SASI_Hs01_00272943 predicted 533
6 SASI_Hs01_00272944 predicted 641
7 SASI_Hs01_00272945 predicted 595
8 SASI_Hs01_00272946 predicted 441
9 SASI_Hs01_00272947 predicted 475
10 SASI_Hs01_00272948 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256988 predicted 694
2 SASI_Hs01_00256989 predicted 446
3 SASI_Hs01_00256990 predicted 567
4 SASI_Hs01_00256991 predicted 497
5 SASI_Hs01_00256992 predicted 202
6 SASI_Hs01_00256993 predicted 368
7 SASI_Hs01_00256994 predicted 228
8 SASI_Hs01_00256995 predicted 303
9 SASI_Hs01_00256996 predicted 561
10 SASI_Hs01_00256997 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264516 predicted 688
2 SASI_Hs01_00264517 predicted 442
3 SASI_Hs01_00264518 predicted 574
4 SASI_Hs01_00264519 predicted 497
5 SASI_Hs01_00264520 predicted 204
6 SASI_Hs01_00264521 predicted 372
7 SASI_Hs01_00264522 predicted 230
8 SASI_Hs01_00264523 predicted 297
9 SASI_Hs01_00264524 predicted 563
10 SASI_Hs01_00264525 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271847 predicted 2332
2 SASI_Hs01_00271848 predicted 2203
3 SASI_Hs01_00271849 predicted 2258
4 SASI_Hs01_00271850 predicted 2430
5 SASI_Hs01_00271851 predicted 2245
6 SASI_Hs01_00271852 predicted 2341
7 SASI_Hs01_00271853 predicted 2610
8 SASI_Hs01_00271854 predicted 2434
9 SASI_Hs01_00271855 predicted 2400
10 SASI_Hs01_00271856 predicted 2580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080824
TRABD2A MISSION shRNA Bacterial Glycerol Stock
TraB domain containing 2A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080824.1-1511s21c1
Sequence:CCGGCCATTCCTGTACTCCACATTCCTCGAGGAATGTGGAGTACAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-611s21c1
Sequence:CCGGCCTGACTGAAGTGGACATTAACTCGAGTTAATGTCCACTTCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-537s21c1
Sequence:CCGGGACTACCTCTTCAATGCTATTCTCGAGAATAGCATTGAAGAGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-921s21c1
Sequence:CCGGGCCTTTGGAGCTGGTCATTTCCTCGAGGAAATGACCAGCTCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-213s21c1
Sequence:CCGGTCCTTCTTGTGGACCATTAAGCTCGAGCTTAATGGTCCACAAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080824
TRABD2A MISSION shRNA shRNA Plasmid DNA
TraB domain containing 2A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080824.1-1511s21c1
Sequence:CCGGCCATTCCTGTACTCCACATTCCTCGAGGAATGTGGAGTACAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-611s21c1
Sequence:CCGGCCTGACTGAAGTGGACATTAACTCGAGTTAATGTCCACTTCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-537s21c1
Sequence:CCGGGACTACCTCTTCAATGCTATTCTCGAGAATAGCATTGAAGAGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-921s21c1
Sequence:CCGGGCCTTTGGAGCTGGTCATTTCCTCGAGGAAATGACCAGCTCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-213s21c1
Sequence:CCGGTCCTTCTTGTGGACCATTAAGCTCGAGCTTAATGGTCCACAAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080824
TRABD2A MISSION shRNA Lentiviral Transduction Particles
TraB domain containing 2A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080824.1-1511s21c1
Sequence:CCGGCCATTCCTGTACTCCACATTCCTCGAGGAATGTGGAGTACAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-611s21c1
Sequence:CCGGCCTGACTGAAGTGGACATTAACTCGAGTTAATGTCCACTTCAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-537s21c1
Sequence:CCGGGACTACCTCTTCAATGCTATTCTCGAGAATAGCATTGAAGAGGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-921s21c1
Sequence:CCGGGCCTTTGGAGCTGGTCATTTCCTCGAGGAAATGACCAGCTCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080824.1-213s21c1
Sequence:CCGGTCCTTCTTGTGGACCATTAAGCTCGAGCTTAATGGTCCACAAGAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks