EMAIL THIS PAGE TO A FRIEND

TRABD2B

TraB domain containing 2B

Synonyms: TIKI2
UniProtKB ID: A6NFA1, I6U4Y0
Gene ID:
Mouse(666048) TraB domain containing 2B
Rat(689914) TraB domain containing 2B
chicken(424623) TraB domain containing 2B
dog(610174) TraB domain containing 2B
naked mole-rat(101701838) TraB domain containing 2B
domestic guinea pig(100735778) TraB domain containing 2B
cow(787081) TraB domain containing 2B
sheep(101114410) TraB domain containing 2B
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154281 MISSION® esiRNA esiRNA targeting mouse Gm12824 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001132797 Rosetta Predictions human pricing
XM_001717552 Rosetta Predictions human pricing
XM_371250 Rosetta Predictions human pricing
XM_001072500 Rosetta Predictions rat pricing
NM_001085549 Rosetta Predictions mouse pricing
XM_981216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00389828 predicted 1632
2 SASI_Hs02_00389829 predicted 1085
3 SASI_Hs02_00389830 predicted 1539
4 SASI_Hs02_00389831 predicted 1488
5 SASI_Hs02_00389832 predicted 1408
6 SASI_Hs02_00389833 predicted 1385
7 SASI_Hs02_00389834 predicted 1379
8 SASI_Hs02_00389835 predicted 1711
9 SASI_Hs02_00389836 predicted 1507
10 SASI_Hs02_00389837 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417936 predicted 1825
2 SASI_Hs02_00417937 predicted 1284
3 SASI_Hs02_00417938 predicted 1742
4 SASI_Hs02_00417939 predicted 2358
5 SASI_Hs02_00417940 predicted 1685
6 SASI_Hs02_00417941 predicted 1077
7 SASI_Hs02_00417942 predicted 1608
8 SASI_Hs02_00417943 predicted 1584
9 SASI_Hs02_00417944 predicted 1576
10 SASI_Hs02_00417945 predicted 1914
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479297 predicted 1519
2 SASI_Hs01_00268325 predicted 974
3 SASI_Hs02_00479298 predicted 1433
4 SASI_Hs02_00479299 predicted 413
5 SASI_Hs01_00268330 predicted 1380
6 SASI_Hs02_00479300 predicted 761
7 SASI_Hs02_00479301 predicted 1295
8 SASI_Hs02_00479302 predicted 1270
9 SASI_Hs01_00268334 predicted 1266
10 SASI_Hs02_00479303 predicted 1599
11 SASI_Hs01_00268326 predicted 1850
12 SASI_Hs01_00268327 predicted 1585
13 SASI_Hs01_00268328 predicted 1820
14 SASI_Hs01_00268329 predicted 1572
15 SASI_Hs01_00268331 predicted 1682
16 SASI_Hs01_00268332 predicted 1724
17 SASI_Hs01_00268333 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339443 predicted 264
2 SASI_Rn02_00339444 predicted 380
3 SASI_Rn02_00339445 predicted 952
4 SASI_Rn02_00339446 predicted 363
5 SASI_Rn02_00339447 predicted 210
6 SASI_Rn02_00339448 predicted 468
7 SASI_Rn02_00339449 predicted 316
8 SASI_Rn02_00339450 predicted 313
9 SASI_Rn02_00339451 predicted 1154
10 SASI_Rn02_00339452 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300969 predicted 723
2 SASI_Mm02_00300970 predicted 997
3 SASI_Mm02_00300971 predicted 1758
4 SASI_Mm02_00300972 predicted 737
5 SASI_Mm02_00300973 predicted 1726
6 SASI_Mm02_00300974 predicted 1919
7 SASI_Mm02_00300975 predicted 960
8 SASI_Mm02_00300976 predicted 1822
9 SASI_Mm02_00300977 predicted 336
10 SASI_Mm02_00300978 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276548 predicted 763
2 SASI_Mm01_00276549 predicted 247
3 SASI_Mm01_00276550 predicted 1805
4 SASI_Mm01_00276551 predicted 777
5 SASI_Mm01_00276552 predicted 1770
6 SASI_Mm01_00276553 predicted 1955
7 SASI_Mm01_00276554 predicted 1010
8 SASI_Mm01_00276555 predicted 1861
9 SASI_Mm01_00276556 predicted 374
10 SASI_Mm01_00276557 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085549
TRABD2B MISSION shRNA Bacterial Glycerol Stock
TraB domain containing 2B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4737s21c1
Sequence:CCGGACTCACAACGTTCACCTTATACTCGAGTATAAGGTGAACGTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4966s21c1
Sequence:CCGGCCAGACTTGTGGTAGTAATAACTCGAGTTATTACTACCACAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4443s21c1
Sequence:CCGGTGTATGGCTAGGCCACTTAAACTCGAGTTTAAGTGGCCTAGCCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4629s21c1
Sequence:CCGGCCTGTGGCCTAGCAGATTAAGCTCGAGCTTAATCTGCTAGGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4121s21c1
Sequence:CCGGGTACATGACCAGACCCTATATCTCGAGATATAGGGTCTGGTCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085549
TRABD2B MISSION shRNA shRNA Plasmid DNA
TraB domain containing 2B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4737s21c1
Sequence:CCGGACTCACAACGTTCACCTTATACTCGAGTATAAGGTGAACGTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4966s21c1
Sequence:CCGGCCAGACTTGTGGTAGTAATAACTCGAGTTATTACTACCACAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4443s21c1
Sequence:CCGGTGTATGGCTAGGCCACTTAAACTCGAGTTTAAGTGGCCTAGCCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4629s21c1
Sequence:CCGGCCTGTGGCCTAGCAGATTAAGCTCGAGCTTAATCTGCTAGGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4121s21c1
Sequence:CCGGGTACATGACCAGACCCTATATCTCGAGATATAGGGTCTGGTCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085549
TRABD2B MISSION shRNA Lentiviral Transduction Particles
TraB domain containing 2B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4737s21c1
Sequence:CCGGACTCACAACGTTCACCTTATACTCGAGTATAAGGTGAACGTTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4966s21c1
Sequence:CCGGCCAGACTTGTGGTAGTAATAACTCGAGTTATTACTACCACAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4443s21c1
Sequence:CCGGTGTATGGCTAGGCCACTTAAACTCGAGTTTAAGTGGCCTAGCCATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4629s21c1
Sequence:CCGGCCTGTGGCCTAGCAGATTAAGCTCGAGCTTAATCTGCTAGGCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085549.1-4121s21c1
Sequence:CCGGGTACATGACCAGACCCTATATCTCGAGATATAGGGTCTGGTCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks