EMAIL THIS PAGE TO A FRIEND

TRABD

TraB domain containing

Synonyms: LP6054 PP2447
UniProtKB ID: Q9H4I3, Q19CC5, Q96ED8, Q9H7N1, Q9UGX6, Q9UGX7
Gene ID:
Mouse(67976) TraB domain containing
Rat(300142) TraB domain containing
Zebrafish(322581) TraB domain containing
Horse(100147257) TraB domain containing
domestic cat(101101574) TraB domain containing
dog(607061) TraB domain containing
chicken(417746) TraB domain containing
cow(513765) TraB domain containing
sheep(101114949) TraB domain containing
domestic guinea pig(100721470) TraB domain containing
naked mole-rat(101708873) TraB domain containing
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42647 Anti-PP2447 antibody produced in rabbit IgG fraction of antiserum rat, guinea pig, horse, human, bovine, mouse, canine
western blot pricing
SAB2108242 Anti-TRABD antibody produced in rabbit affinity isolated antibody zebrafish, bovine, guinea pig, horse, mouse, rat, human
western blot pricing
HPA000822 Anti-TRABD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077811 MISSION® esiRNA esiRNA targeting mouse Trabd (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025204 Rosetta Predictions human pricing
NM_001106788 Rosetta Predictions rat pricing
NM_026485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178087 predicted 362
2 SASI_Hs01_00178088 predicted 798
3 SASI_Hs01_00178089 predicted 1081
4 SASI_Hs01_00178090 predicted 602
5 SASI_Hs01_00178091 predicted 637
6 SASI_Hs02_00357979 predicted 1085
7 SASI_Hs01_00178093 predicted 1394
8 SASI_Hs01_00178094 predicted 1124
9 SASI_Hs01_00178095 predicted 1404
10 SASI_Hs01_00178096 predicted 426
11 SASI_Hs01_00178092 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222408 predicted 1261
2 SASI_Rn02_00222409 predicted 342
3 SASI_Rn02_00222410 predicted 1489
4 SASI_Rn02_00222411 predicted 669
5 SASI_Rn02_00222412 predicted 1324
6 SASI_Rn02_00222413 predicted 355
7 SASI_Rn02_00222414 predicted 200
8 SASI_Rn02_00222415 predicted 413
9 SASI_Rn02_00222416 predicted 1408
10 SASI_Rn02_00222417 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046783 predicted 876
2 SASI_Mm01_00046784 predicted 1008
3 SASI_Mm01_00046785 predicted 684
4 SASI_Mm01_00046786 predicted 881
5 SASI_Mm01_00046787 predicted 637
6 SASI_Mm02_00330356 predicted 366
7 SASI_Mm01_00046789 predicted 1085
8 SASI_Mm02_00330357 predicted 1406
9 SASI_Mm01_00046791 predicted 1509
10 SASI_Mm01_00046792 predicted 1129
11 SASI_Mm01_00046788 predicted 764
12 SASI_Mm01_00046790 predicted 810
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025204
VALIDATED
TRABD MISSION shRNA Bacterial Glycerol Stock
TraB domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025204.2-1395s1c1
Sequence:CCGGGCCCACCCAAATAAAGGATTACTCGAGTAATCCTTTATTTGGGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025204.2-1868s1c1
Sequence:CCGGCCTTAAATCCAAAGGGAGAGACTCGAGTCTCTCCCTTTGGATTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025204.2-426s1c1
Sequence:CCGGCTGCCAATATCGTGTGTCCATCTCGAGATGGACACACGATATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025204.2-793s1c1
Sequence:CCGGCGCTGCAAGCAGAAGGACCTACTCGAGTAGGTCCTTCTGCTTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025204.2-1397s1c1
Sequence:CCGGCCACCCAAATAAAGGATTATTCTCGAGAATAATCCTTTATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025204.2-882s1c1
Sequence:CCGGCGACGTCTACCTAACCTACATCTCGAGATGTAGGTTAGGTAGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025204.2-1395s21c1
Sequence:CCGGGCCCACCCAAATAAAGGATTACTCGAGTAATCCTTTATTTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-793s21c1
Sequence:CCGGCGCTGCAAGCAGAAGGACCTACTCGAGTAGGTCCTTCTGCTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-1868s21c1
Sequence:CCGGCCTTAAATCCAAAGGGAGAGACTCGAGTCTCTCCCTTTGGATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-821s21c1
Sequence:CCGGAGATGATGGCCGAGATGATTGCTCGAGCAATCATCTCGGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025204.2-883s21c1
Sequence:CCGGGACGTCTACCTAACCTACATGCTCGAGCATGTAGGTTAGGTAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025204
VALIDATED
TRABD MISSION shRNA shRNA Plasmid DNA
TraB domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025204.2-1395s1c1
Sequence:CCGGGCCCACCCAAATAAAGGATTACTCGAGTAATCCTTTATTTGGGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025204.2-1868s1c1
Sequence:CCGGCCTTAAATCCAAAGGGAGAGACTCGAGTCTCTCCCTTTGGATTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025204.2-426s1c1
Sequence:CCGGCTGCCAATATCGTGTGTCCATCTCGAGATGGACACACGATATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025204.2-793s1c1
Sequence:CCGGCGCTGCAAGCAGAAGGACCTACTCGAGTAGGTCCTTCTGCTTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025204.2-1397s1c1
Sequence:CCGGCCACCCAAATAAAGGATTATTCTCGAGAATAATCCTTTATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025204.2-882s1c1
Sequence:CCGGCGACGTCTACCTAACCTACATCTCGAGATGTAGGTTAGGTAGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025204.2-1395s21c1
Sequence:CCGGGCCCACCCAAATAAAGGATTACTCGAGTAATCCTTTATTTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-793s21c1
Sequence:CCGGCGCTGCAAGCAGAAGGACCTACTCGAGTAGGTCCTTCTGCTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-1868s21c1
Sequence:CCGGCCTTAAATCCAAAGGGAGAGACTCGAGTCTCTCCCTTTGGATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-821s21c1
Sequence:CCGGAGATGATGGCCGAGATGATTGCTCGAGCAATCATCTCGGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025204.2-883s21c1
Sequence:CCGGGACGTCTACCTAACCTACATGCTCGAGCATGTAGGTTAGGTAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025204
VALIDATED
TRABD MISSION shRNA Lentiviral Transduction Particles
TraB domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025204.2-1395s1c1
Sequence:CCGGGCCCACCCAAATAAAGGATTACTCGAGTAATCCTTTATTTGGGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025204.2-1868s1c1
Sequence:CCGGCCTTAAATCCAAAGGGAGAGACTCGAGTCTCTCCCTTTGGATTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025204.2-426s1c1
Sequence:CCGGCTGCCAATATCGTGTGTCCATCTCGAGATGGACACACGATATTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025204.2-793s1c1
Sequence:CCGGCGCTGCAAGCAGAAGGACCTACTCGAGTAGGTCCTTCTGCTTGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025204.2-1397s1c1
Sequence:CCGGCCACCCAAATAAAGGATTATTCTCGAGAATAATCCTTTATTTGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184393    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025204.2-882s1c1
Sequence:CCGGCGACGTCTACCTAACCTACATCTCGAGATGTAGGTTAGGTAGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025204.2-1395s21c1
Sequence:CCGGGCCCACCCAAATAAAGGATTACTCGAGTAATCCTTTATTTGGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-793s21c1
Sequence:CCGGCGCTGCAAGCAGAAGGACCTACTCGAGTAGGTCCTTCTGCTTGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275621    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-1868s21c1
Sequence:CCGGCCTTAAATCCAAAGGGAGAGACTCGAGTCTCTCCCTTTGGATTTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025204.2-821s21c1
Sequence:CCGGAGATGATGGCCGAGATGATTGCTCGAGCAATCATCTCGGCCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025204.2-883s21c1
Sequence:CCGGGACGTCTACCTAACCTACATGCTCGAGCATGTAGGTTAGGTAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026485
VALIDATED
TRABD MISSION shRNA Bacterial Glycerol Stock
TraB domain containing
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026485.1-1408s1c1
Sequence:CCGGCCCACCCAAATAAAGAATATTCTCGAGAATATTCTTTATTTGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026485.1-1012s1c1
Sequence:CCGGGCATTGAGAAGAACTGGAGTACTCGAGTACTCCAGTTCTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026485.1-687s1c1
Sequence:CCGGGTCACCTTTAAGAGGGCCATTCTCGAGAATGGCCCTCTTAAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026485.2-2201s21c1
Sequence:CCGGCAGGCTGTGGCTCCTAGTATACTCGAGTATACTAGGAGCCACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-888s21c1
Sequence:CCGGGACGTCTATCTGACCTATATGCTCGAGCATATAGGTCAGATAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-521s21c1
Sequence:CCGGTGTCAGGCAGAATGGGCTTATCTCGAGATAAGCCCATTCTGCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-684s21c1
Sequence:CCGGCCAATCCCAGTCACCTTTAAGCTCGAGCTTAAAGGTGACTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026485.2-619s21c1
Sequence:CCGGAGTTCAGGGAGGCCTTCAAAGCTCGAGCTTTGAAGGCCTCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026485
VALIDATED
TRABD MISSION shRNA shRNA Plasmid DNA
TraB domain containing
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026485.1-1408s1c1
Sequence:CCGGCCCACCCAAATAAAGAATATTCTCGAGAATATTCTTTATTTGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026485.1-1012s1c1
Sequence:CCGGGCATTGAGAAGAACTGGAGTACTCGAGTACTCCAGTTCTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026485.1-687s1c1
Sequence:CCGGGTCACCTTTAAGAGGGCCATTCTCGAGAATGGCCCTCTTAAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026485.2-2201s21c1
Sequence:CCGGCAGGCTGTGGCTCCTAGTATACTCGAGTATACTAGGAGCCACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-888s21c1
Sequence:CCGGGACGTCTATCTGACCTATATGCTCGAGCATATAGGTCAGATAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-521s21c1
Sequence:CCGGTGTCAGGCAGAATGGGCTTATCTCGAGATAAGCCCATTCTGCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-684s21c1
Sequence:CCGGCCAATCCCAGTCACCTTTAAGCTCGAGCTTAAAGGTGACTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026485.2-619s21c1
Sequence:CCGGAGTTCAGGGAGGCCTTCAAAGCTCGAGCTTTGAAGGCCTCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026485
VALIDATED
TRABD MISSION shRNA Lentiviral Transduction Particles
TraB domain containing
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026485.1-1408s1c1
Sequence:CCGGCCCACCCAAATAAAGAATATTCTCGAGAATATTCTTTATTTGGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026485.1-1012s1c1
Sequence:CCGGGCATTGAGAAGAACTGGAGTACTCGAGTACTCCAGTTCTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026485.1-687s1c1
Sequence:CCGGGTCACCTTTAAGAGGGCCATTCTCGAGAATGGCCCTCTTAAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026485.2-2201s21c1
Sequence:CCGGCAGGCTGTGGCTCCTAGTATACTCGAGTATACTAGGAGCCACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-888s21c1
Sequence:CCGGGACGTCTATCTGACCTATATGCTCGAGCATATAGGTCAGATAGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-521s21c1
Sequence:CCGGTGTCAGGCAGAATGGGCTTATCTCGAGATAAGCCCATTCTGCCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026485.2-684s21c1
Sequence:CCGGCCAATCCCAGTCACCTTTAAGCTCGAGCTTAAAGGTGACTGGGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026485.2-619s21c1
Sequence:CCGGAGTTCAGGGAGGCCTTCAAAGCTCGAGCTTTGAAGGCCTCCCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks