EMAIL THIS PAGE TO A FRIEND

TRADD

TNFRSF1A-associated via death domain

Synonyms: Hs.89862
UniProtKB ID: Q15628, B2RDS3, Q52NZ1
Gene ID:
Human(8717) Summary: The protein encoded by this gene is a death domain containing adaptor molecule that interacts with TNFRSF1A/TNFR1 and mediates programmed cell death signaling and NF-kappaB activation. This protein binds adaptor protein TRAF2, reduces the recruitment of inhibitor-of-apoptosis proteins (IAPs) by TRAF2, and thus suppresses TRAF2 mediated apoptosis. This protein can also interact with receptor TNFRSF6/FAS and adaptor protein FADD/MORT1, and is involved in the Fas-induced cell death pathway. [provided by RefSeq, Jul 2008]
Mouse(71609) TNFRSF1A-associated via death domain
Rat(246756) TNFRSF1A-associated via death domain
Zebrafish(58130) tnfrsf1a-associated via death domain
chicken(415700) TNFRSF1A-associated via death domain
dog(611262) TNFRSF1A-associated via death domain
domestic cat(101097773) TNFRSF1A-associated via death domain
cow(504707) TNFRSF1A-associated via death domain
sheep(101111042) TNFRSF1A-associated via death domain
domestic guinea pig(100732953) TNFRSF1A-associated via death domain
naked mole-rat(101721567) TNFRSF1A-associated via death domain
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158871 MISSION® esiRNA esiRNA human TRADD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003789 Rosetta Predictions human pricing
NM_153425 Rosetta Predictions human pricing
XM_001071920 Rosetta Predictions rat pricing
XM_341671 Rosetta Predictions rat pricing
NM_001033161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097479 predicted 994
2 SASI_Hs01_00097481 predicted 477
3 SASI_Hs01_00097482 predicted 1105
4 SASI_Hs02_00336293 predicted 290
5 SASI_Hs01_00097483 predicted 850
6 SASI_Hs01_00097485 predicted 627
7 SASI_Hs01_00097486 predicted 515
8 SASI_Hs01_00097487 predicted 541
9 SASI_Hs02_00336294 predicted 455
10 SASI_Hs02_00336295 predicted 1104
11 SASI_Hs01_00097478 predicted 687
12 SASI_Hs01_00097480 predicted 1052
13 SASI_Hs01_00097484 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209536 predicted 1154
2 SASI_Hs01_00209537 predicted 1475
3 SASI_Hs01_00209538 predicted 1535
4 SASI_Hs01_00209539 predicted 949
5 SASI_Hs01_00209540 predicted 1583
6 SASI_Hs01_00209541 predicted 1328
7 SASI_Hs01_00209542 predicted 1160
8 SASI_Hs01_00209543 predicted 1110
9 SASI_Hs01_00209544 predicted 994
10 SASI_Hs01_00209545 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337000 predicted 236
2 SASI_Rn02_00337001 predicted 919
3 SASI_Rn02_00337002 predicted 203
4 SASI_Rn02_00337003 predicted 1285
5 SASI_Rn02_00337004 predicted 1178
6 SASI_Rn02_00337005 predicted 527
7 SASI_Rn02_00337006 predicted 1345
8 SASI_Rn02_00337007 predicted 673
9 SASI_Rn02_00337008 predicted 1269
10 SASI_Rn02_00337009 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166607 predicted 231
2 SASI_Rn01_00166608 predicted 920
3 SASI_Rn01_00166609 predicted 210
4 SASI_Rn01_00166610 predicted 1283
5 SASI_Rn02_00393231 predicted 1177
6 SASI_Rn02_00393232 predicted 528
7 SASI_Rn01_00166613 predicted 1346
8 SASI_Rn01_00166614 predicted 665
9 SASI_Rn01_00166615 predicted 1273
10 SASI_Rn01_00166616 predicted 867
11 SASI_Rn01_00166611 predicted 473
12 SASI_Rn01_00166612 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032853 predicted 208
2 SASI_Mm01_00032855 predicted 796
3 SASI_Mm01_00032856 predicted 836
4 SASI_Mm01_00032857 predicted 926
5 SASI_Mm01_00032858 predicted 566
6 SASI_Mm01_00032859 predicted 641
7 SASI_Mm01_00032860 predicted 415
8 SASI_Mm01_00032861 predicted 908
9 SASI_Mm01_00032862 predicted 554
10 SASI_Mm02_00288240 predicted 785
11 SASI_Mm01_00032854 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003789
VALIDATED
TRADD MISSION shRNA Bacterial Glycerol Stock
TNFRSF1A-associated via death domain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-748s21c1
Sequence:CCGGCGCGCTCTGTGGGTCTCAAATCTCGAGATTTGAGACCCACAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003789.3-1109s21c1
Sequence:CCGGCTGAAACTCCACTTGGCCTATCTCGAGATAGGCCAAGTGGAGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-632s21c1
Sequence:CCGGGCCCTCTCTGTCGGAGGTGAACTCGAGTTCACCTCCGACAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-480s21c1
Sequence:CCGGCGCTGTTTGAGTTGCATCCTACTCGAGTAGGATGCAACTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-694s21c1
Sequence:CCGGAGGGTCAGCCTGTAGTGAATCCTCGAGGATTCACTACAGGCTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003789.2-1102s1c1
Sequence:CCGGCTGAAACTCCACTTGGCCTATCTCGAGATAGGCCAAGTGGAGTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-625s1c1
Sequence:CCGGGCCCTCTCTGTCGGAGGTGAACTCGAGTTCACCTCCGACAGAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-473s1c1
Sequence:CCGGCGCTGTTTGAGTTGCATCCTACTCGAGTAGGATGCAACTCAAACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-741s1c1
Sequence:CCGGCGCGCTCTGTGGGTCTCAAATCTCGAGATTTGAGACCCACAGAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003789.2-178s1c1
Sequence:CCGGCCAGCAGAAGGTGGCAGTGTACTCGAGTACACTGCCACCTTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003789
VALIDATED
TRADD MISSION shRNA shRNA Plasmid DNA
TNFRSF1A-associated via death domain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-748s21c1
Sequence:CCGGCGCGCTCTGTGGGTCTCAAATCTCGAGATTTGAGACCCACAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003789.3-1109s21c1
Sequence:CCGGCTGAAACTCCACTTGGCCTATCTCGAGATAGGCCAAGTGGAGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-632s21c1
Sequence:CCGGGCCCTCTCTGTCGGAGGTGAACTCGAGTTCACCTCCGACAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-480s21c1
Sequence:CCGGCGCTGTTTGAGTTGCATCCTACTCGAGTAGGATGCAACTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-694s21c1
Sequence:CCGGAGGGTCAGCCTGTAGTGAATCCTCGAGGATTCACTACAGGCTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003789.2-1102s1c1
Sequence:CCGGCTGAAACTCCACTTGGCCTATCTCGAGATAGGCCAAGTGGAGTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-625s1c1
Sequence:CCGGGCCCTCTCTGTCGGAGGTGAACTCGAGTTCACCTCCGACAGAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-473s1c1
Sequence:CCGGCGCTGTTTGAGTTGCATCCTACTCGAGTAGGATGCAACTCAAACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-741s1c1
Sequence:CCGGCGCGCTCTGTGGGTCTCAAATCTCGAGATTTGAGACCCACAGAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003789.2-178s1c1
Sequence:CCGGCCAGCAGAAGGTGGCAGTGTACTCGAGTACACTGCCACCTTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003789
VALIDATED
TRADD MISSION shRNA Lentiviral Transduction Particles
TNFRSF1A-associated via death domain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-748s21c1
Sequence:CCGGCGCGCTCTGTGGGTCTCAAATCTCGAGATTTGAGACCCACAGAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003789.3-1109s21c1
Sequence:CCGGCTGAAACTCCACTTGGCCTATCTCGAGATAGGCCAAGTGGAGTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-632s21c1
Sequence:CCGGGCCCTCTCTGTCGGAGGTGAACTCGAGTTCACCTCCGACAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-480s21c1
Sequence:CCGGCGCTGTTTGAGTTGCATCCTACTCGAGTAGGATGCAACTCAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003789.3-694s21c1
Sequence:CCGGAGGGTCAGCCTGTAGTGAATCCTCGAGGATTCACTACAGGCTGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_003789.2-1102s1c1
Sequence:CCGGCTGAAACTCCACTTGGCCTATCTCGAGATAGGCCAAGTGGAGTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-625s1c1
Sequence:CCGGGCCCTCTCTGTCGGAGGTGAACTCGAGTTCACCTCCGACAGAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-473s1c1
Sequence:CCGGCGCTGTTTGAGTTGCATCCTACTCGAGTAGGATGCAACTCAAACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003789.2-741s1c1
Sequence:CCGGCGCGCTCTGTGGGTCTCAAATCTCGAGATTTGAGACCCACAGAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003789.2-178s1c1
Sequence:CCGGCCAGCAGAAGGTGGCAGTGTACTCGAGTACACTGCCACCTTCTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033161
VALIDATED
TRADD MISSION shRNA Bacterial Glycerol Stock
TNFRSF1A-associated via death domain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-1004s21c1
Sequence:CCGGCCAGCAGTTCAGTGTTTGAAACTCGAGTTTCAAACACTGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-147s21c1
Sequence:CCGGCAAGAAGAAGGTGGCAATATACTCGAGTATATTGCCACCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-213s21c1
Sequence:CCGGCGTACTGCAGATACTCAAGATCTCGAGATCTTGAGTATCTGCAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-1227s21c1
Sequence:CCGGGCTGCAAAGACCCTCTAAGTACTCGAGTACTTAGAGGGTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-801s21c1
Sequence:CCGGGTATGAGCGTGATGGGCTATACTCGAGTATAGCCCATCACGCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-1227s1c1
Sequence:CCGGGCTGCAAAGACCCTCTAAGTACTCGAGTACTTAGAGGGTCTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-450s1c1
Sequence:CCGGGAATTACATCTTAGCCCAGAACTCGAGTTCTGGGCTAAGATGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-213s1c1
Sequence:CCGGCGTACTGCAGATACTCAAGATCTCGAGATCTTGAGTATCTGCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-1004s1c1
Sequence:CCGGCCAGCAGTTCAGTGTTTGAAACTCGAGTTTCAAACACTGAACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033161
VALIDATED
TRADD MISSION shRNA shRNA Plasmid DNA
TNFRSF1A-associated via death domain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-1004s21c1
Sequence:CCGGCCAGCAGTTCAGTGTTTGAAACTCGAGTTTCAAACACTGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-147s21c1
Sequence:CCGGCAAGAAGAAGGTGGCAATATACTCGAGTATATTGCCACCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-213s21c1
Sequence:CCGGCGTACTGCAGATACTCAAGATCTCGAGATCTTGAGTATCTGCAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-1227s21c1
Sequence:CCGGGCTGCAAAGACCCTCTAAGTACTCGAGTACTTAGAGGGTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-801s21c1
Sequence:CCGGGTATGAGCGTGATGGGCTATACTCGAGTATAGCCCATCACGCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-1227s1c1
Sequence:CCGGGCTGCAAAGACCCTCTAAGTACTCGAGTACTTAGAGGGTCTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-450s1c1
Sequence:CCGGGAATTACATCTTAGCCCAGAACTCGAGTTCTGGGCTAAGATGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-213s1c1
Sequence:CCGGCGTACTGCAGATACTCAAGATCTCGAGATCTTGAGTATCTGCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-1004s1c1
Sequence:CCGGCCAGCAGTTCAGTGTTTGAAACTCGAGTTTCAAACACTGAACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033161
VALIDATED
TRADD MISSION shRNA Lentiviral Transduction Particles
TNFRSF1A-associated via death domain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-1004s21c1
Sequence:CCGGCCAGCAGTTCAGTGTTTGAAACTCGAGTTTCAAACACTGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-147s21c1
Sequence:CCGGCAAGAAGAAGGTGGCAATATACTCGAGTATATTGCCACCTTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-213s21c1
Sequence:CCGGCGTACTGCAGATACTCAAGATCTCGAGATCTTGAGTATCTGCAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341633    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-1227s21c1
Sequence:CCGGGCTGCAAAGACCCTCTAAGTACTCGAGTACTTAGAGGGTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033161.2-801s21c1
Sequence:CCGGGTATGAGCGTGATGGGCTATACTCGAGTATAGCCCATCACGCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-1227s1c1
Sequence:CCGGGCTGCAAAGACCCTCTAAGTACTCGAGTACTTAGAGGGTCTTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-450s1c1
Sequence:CCGGGAATTACATCTTAGCCCAGAACTCGAGTTCTGGGCTAAGATGTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-213s1c1
Sequence:CCGGCGTACTGCAGATACTCAAGATCTCGAGATCTTGAGTATCTGCAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033161.1-1004s1c1
Sequence:CCGGCCAGCAGTTCAGTGTTTGAAACTCGAGTTTCAAACACTGAACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks