EMAIL THIS PAGE TO A FRIEND

TRAF1

TNF receptor-associated factor 1

Synonyms: EBI6 MGC:10353
UniProtKB ID: Q13077, B4DJ77, Q658U1, Q8NF13
Gene ID:
Human(7185) Summary: The protein encoded by this gene is a member of the TNF receptor (TNFR) associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from various receptors of the TNFR superfamily. This protein and TRAF2 form a heterodimeric complex, which is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF2 also interacts with inhibitor-of-apoptosis proteins (IAPs), and thus mediates the anti-apoptotic signals from TNF receptors. The expression of this protein can be induced by Epstein-Barr virus (EBV). EBV infection membrane protein 1 (LMP1) is found to interact with this and other TRAF proteins; this interaction is thought to link LMP1-mediated B lymphocyte transformation to the signal transduction from TNFR family receptors. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(22029) TNF receptor-associated factor 1
Rat(687813) TNF receptor-associated factor 1
Zebrafish(100148503) TNF receptor-associated factor 1
domestic cat(101087620) TNF receptor-associated factor 1
Horse(100067681) TNF receptor-associated factor 1
dog(612709) TNF receptor-associated factor 1
chicken(417123) TNF receptor-associated factor 1
naked mole-rat(101710804) TNF receptor-associated factor 1
Domestic Rabbit(100338847) TNF receptor-associated factor 1
domestic guinea pig(100723139) TNF receptor-associated factor 1
cow(540944) TNF receptor-associated factor 1
sheep(101122077) TNF receptor-associated factor 1
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005658 Rosetta Predictions human pricing
XM_001080233 Rosetta Predictions rat pricing
NM_009421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155359 predicted 705
2 SASI_Hs01_00155360 predicted 1466
3 SASI_Hs02_00340028 predicted 2118
4 SASI_Hs01_00155361 predicted 1893
5 SASI_Hs01_00155362 predicted 1588
6 SASI_Hs01_00155363 predicted 1897
7 SASI_Hs01_00155364 predicted 1778
8 SASI_Hs01_00155366 predicted 1525
9 SASI_Hs01_00155367 predicted 750
10 SASI_Hs01_00155368 predicted 1749
11 SASI_Hs01_00155365 predicted 1894
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367186 predicted 1220
2 SASI_Rn02_00367187 predicted 1405
3 SASI_Rn02_00367188 predicted 1561
4 SASI_Rn02_00367189 predicted 1601
5 SASI_Rn02_00367190 predicted 314
6 SASI_Rn02_00367191 predicted 1389
7 SASI_Rn02_00367192 predicted 455
8 SASI_Rn02_00367193 predicted 1078
9 SASI_Rn02_00367194 predicted 1554
10 SASI_Rn02_00367195 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145355 predicted 723
2 SASI_Mm01_00145356 predicted 629
3 SASI_Mm01_00145357 predicted 1482
4 SASI_Mm01_00145358 predicted 1352
5 SASI_Mm01_00145359 predicted 813
6 SASI_Mm01_00145361 predicted 1664
7 SASI_Mm01_00145362 predicted 1489
8 SASI_Mm01_00145363 predicted 619
9 SASI_Mm01_00145364 predicted 592
10 SASI_Mm02_00316078 predicted 751
11 SASI_Mm01_00145360 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005658
TRAF1 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-612s1c1
Sequence:CCGGGATGAGAATGAGTTTCCCTTTCTCGAGAAAGGGAAACTCATTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1802s1c1
Sequence:CCGGCATTGTGGAGACCAGCACTTACTCGAGTAAGTGCTGGTCTCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1155s1c1
Sequence:CCGGCGTGTGTTTGAGAACATTGTTCTCGAGAACAATGTTCTCAAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1455s1c1
Sequence:CCGGGCCTTCTACACTGCCAAGTATCTCGAGATACTTGGCAGTGTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005658.3-3414s1c1
Sequence:CCGGGCAGTCTCAATGGGTCAGAAACTCGAGTTTCTGACCCATTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1153s21c1
Sequence:CCGGTGCGTGTGTTTGAGAACATTGCTCGAGCAATGTTCTCAAACACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1537s21c1
Sequence:CCGGTGTCGCTCTTCATCGTGATCACTCGAGTGATCACGATGAAGAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1768s21c1
Sequence:CCGGCCTACGTGAAGGACGACACAACTCGAGTTGTGTCGTCCTTCACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1456s21c1
Sequence:CCGGCCTTCTACACTGCCAAGTATGCTCGAGCATACTTGGCAGTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005658
TRAF1 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-612s1c1
Sequence:CCGGGATGAGAATGAGTTTCCCTTTCTCGAGAAAGGGAAACTCATTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1802s1c1
Sequence:CCGGCATTGTGGAGACCAGCACTTACTCGAGTAAGTGCTGGTCTCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1155s1c1
Sequence:CCGGCGTGTGTTTGAGAACATTGTTCTCGAGAACAATGTTCTCAAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1455s1c1
Sequence:CCGGGCCTTCTACACTGCCAAGTATCTCGAGATACTTGGCAGTGTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005658.3-3414s1c1
Sequence:CCGGGCAGTCTCAATGGGTCAGAAACTCGAGTTTCTGACCCATTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1153s21c1
Sequence:CCGGTGCGTGTGTTTGAGAACATTGCTCGAGCAATGTTCTCAAACACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1537s21c1
Sequence:CCGGTGTCGCTCTTCATCGTGATCACTCGAGTGATCACGATGAAGAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1768s21c1
Sequence:CCGGCCTACGTGAAGGACGACACAACTCGAGTTGTGTCGTCCTTCACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1456s21c1
Sequence:CCGGCCTTCTACACTGCCAAGTATGCTCGAGCATACTTGGCAGTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005658
TRAF1 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-612s1c1
Sequence:CCGGGATGAGAATGAGTTTCCCTTTCTCGAGAAAGGGAAACTCATTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1802s1c1
Sequence:CCGGCATTGTGGAGACCAGCACTTACTCGAGTAAGTGCTGGTCTCCACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1155s1c1
Sequence:CCGGCGTGTGTTTGAGAACATTGTTCTCGAGAACAATGTTCTCAAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005658.3-1455s1c1
Sequence:CCGGGCCTTCTACACTGCCAAGTATCTCGAGATACTTGGCAGTGTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005658.3-3414s1c1
Sequence:CCGGGCAGTCTCAATGGGTCAGAAACTCGAGTTTCTGACCCATTGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1153s21c1
Sequence:CCGGTGCGTGTGTTTGAGAACATTGCTCGAGCAATGTTCTCAAACACACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1537s21c1
Sequence:CCGGTGTCGCTCTTCATCGTGATCACTCGAGTGATCACGATGAAGAGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1768s21c1
Sequence:CCGGCCTACGTGAAGGACGACACAACTCGAGTTGTGTCGTCCTTCACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005658.3-1456s21c1
Sequence:CCGGCCTTCTACACTGCCAAGTATGCTCGAGCATACTTGGCAGTGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009421
TRAF1 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1657s1c1
Sequence:CCGGCCTACGTCAAAGATGACACAACTCGAGTTGTGTCATCTTTGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1344s1c1
Sequence:CCGGGCTTTCTACACTGCCAAGTATCTCGAGATACTTGGCAGTGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009421.2-1990s1c1
Sequence:CCGGCCAGCCTAGATCAGGATGAAACTCGAGTTTCATCCTGATCTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-822s1c1
Sequence:CCGGGCGGTCTTAAAGGAGTGGAAACTCGAGTTTCCACTCCTTTAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1040s1c1
Sequence:CCGGGCTGCGTGTGTTTGCAAACATCTCGAGATGTTTGCAAACACACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-612s21c1
Sequence:CCGGGGATCGGATCTGTCCTAAATGCTCGAGCATTTAGGACAGATCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-1517s21c1
Sequence:CCGGACAACCGAGAGCATGCTATTGCTCGAGCAATAGCATGCTCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-1246s21c1
Sequence:CCGGGCATCCTTTGATGGTACTTTCCTCGAGGAAAGTACCATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009421
TRAF1 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1657s1c1
Sequence:CCGGCCTACGTCAAAGATGACACAACTCGAGTTGTGTCATCTTTGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1344s1c1
Sequence:CCGGGCTTTCTACACTGCCAAGTATCTCGAGATACTTGGCAGTGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009421.2-1990s1c1
Sequence:CCGGCCAGCCTAGATCAGGATGAAACTCGAGTTTCATCCTGATCTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-822s1c1
Sequence:CCGGGCGGTCTTAAAGGAGTGGAAACTCGAGTTTCCACTCCTTTAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1040s1c1
Sequence:CCGGGCTGCGTGTGTTTGCAAACATCTCGAGATGTTTGCAAACACACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-612s21c1
Sequence:CCGGGGATCGGATCTGTCCTAAATGCTCGAGCATTTAGGACAGATCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-1517s21c1
Sequence:CCGGACAACCGAGAGCATGCTATTGCTCGAGCAATAGCATGCTCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-1246s21c1
Sequence:CCGGGCATCCTTTGATGGTACTTTCCTCGAGGAAAGTACCATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009421
TRAF1 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1657s1c1
Sequence:CCGGCCTACGTCAAAGATGACACAACTCGAGTTGTGTCATCTTTGACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1344s1c1
Sequence:CCGGGCTTTCTACACTGCCAAGTATCTCGAGATACTTGGCAGTGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009421.2-1990s1c1
Sequence:CCGGCCAGCCTAGATCAGGATGAAACTCGAGTTTCATCCTGATCTAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-822s1c1
Sequence:CCGGGCGGTCTTAAAGGAGTGGAAACTCGAGTTTCCACTCCTTTAAGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009421.2-1040s1c1
Sequence:CCGGGCTGCGTGTGTTTGCAAACATCTCGAGATGTTTGCAAACACACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-612s21c1
Sequence:CCGGGGATCGGATCTGTCCTAAATGCTCGAGCATTTAGGACAGATCCGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-1517s21c1
Sequence:CCGGACAACCGAGAGCATGCTATTGCTCGAGCAATAGCATGCTCTCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009421.3-1246s21c1
Sequence:CCGGGCATCCTTTGATGGTACTTTCCTCGAGGAAAGTACCATCAAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks