EMAIL THIS PAGE TO A FRIEND

TRAF2

TNF receptor-associated factor 2

Synonyms: MGC:45012 TRAP TRAP3
UniProtKB ID: Q12933, A8K107, B4DPJ7, Q7Z337, Q96NT2
Gene ID:
Human(7186) Summary: The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from members of the TNF receptor superfamily. This protein directly interacts with TNF receptors, and forms a heterodimeric complex with TRAF1. This protein is required for TNF-alpha-mediated activation of MAPK8/JNK and NF-kappaB. The protein complex formed by this protein and TRAF1 interacts with the inhibitor-of-apoptosis proteins (IAPs), and functions as a mediator of the anti-apoptotic signals from TNF receptors. The interaction of this protein with TRADD, a TNF receptor associated apoptotic signal transducer, ensures the recruitment of IAPs for the direct inhibition of caspase activation. BIRC2/c-IAP1, an apoptosis inhibitor possessing ubiquitin ligase activity, can unbiquitinate and induce the degradation of this protein, and thus potentiate TNF-induced apoptosis. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of only one transcript has been determined. [provided by RefSeq, Jul 2008]
Mouse(22030) TNF receptor-associated factor 2
Rat(311786) Tnf receptor-associated factor 2
cow(512355) TNF receptor-associated factor 2
domestic guinea pig(100733145) TNF receptor-associated factor 2
naked mole-rat(101705156) TNF receptor-associated factor 2
chicken(417287) TNF receptor-associated factor 2
domestic cat(101096363) TNF receptor-associated factor 2
dog(480673) TNF receptor-associated factor 2
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021138 Rosetta Predictions human pricing
NM_001107815 Rosetta Predictions rat pricing
NM_009422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095954 predicted 1389
2 SASI_Hs01_00095956 predicted 666
3 SASI_Hs01_00095957 predicted 644
4 SASI_Hs01_00095958 predicted 457
5 SASI_Hs01_00095959 predicted 683
6 SASI_Hs01_00095960 predicted 1506
7 SASI_Hs01_00095961 predicted 316
8 SASI_Hs02_00354661 predicted 1425
9 SASI_Hs01_00095963 predicted 1167
10 SASI_Hs02_00354662 predicted 614
11 SASI_Hs01_00095955 predicted 1886
12 SASI_Hs01_00095962 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232545 predicted 656
2 SASI_Rn02_00232546 predicted 1238
3 SASI_Rn02_00232547 predicted 1367
4 SASI_Rn02_00232548 predicted 1279
5 SASI_Rn02_00232549 predicted 832
6 SASI_Rn02_00232550 predicted 1181
7 SASI_Rn02_00232551 predicted 591
8 SASI_Rn02_00232552 predicted 243
9 SASI_Rn02_00232553 predicted 906
10 SASI_Rn02_00232554 predicted 975
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024368 predicted 277
2 SASI_Mm01_00024369 predicted 1497
3 SASI_Mm01_00024370 predicted 676
4 SASI_Mm02_00316079 predicted 1532
5 SASI_Mm01_00024372 predicted 1315
6 SASI_Mm01_00024373 predicted 1240
7 SASI_Mm01_00024374 predicted 1207
8 SASI_Mm01_00024375 predicted 619
9 SASI_Mm01_00024376 predicted 1527
10 SASI_Mm01_00024377 predicted 619
11 SASI_Mm01_00024371 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021138
TRAF2 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-1370s21c1
Sequence:CCGGATAACCGGGAGCACGTGATTGCTCGAGCAATCACGTGCTCCCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-691s21c1
Sequence:CCGGTGTCGAGTCCCTTGCAGATTCCTCGAGGAATCTGCAAGGGACTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-272s21c1
Sequence:CCGGGTGTTCACGAGGGCATATATGCTCGAGCATATATGCCCTCGTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-320s21c1
Sequence:CCGGGTTCGGCCTTCCCAGATAATGCTCGAGCATTATCTGGGAAGGCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-1362s1c1
Sequence:CCGGCGACCAGAATAACCGGGAGCACTCGAGTGCTCCCGGTTATTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-699s1c1
Sequence:CCGGCCCTTGCAGATTCCACGCCATCTCGAGATGGCGTGGAATCTGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021138.x-1955s1c1
Sequence:CCGGCTCGGGCATGACAGGCAGAAACTCGAGTTTCTGCCTGTCATGCCCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-729s1c1
Sequence:CCGGCGAGACGGTAGAGGGTGAGAACTCGAGTTCTCACCCTCTACCGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-407s1c1
Sequence:CCGGCCCTGAAAGAATACGAGAGCTCTCGAGAGCTCTCGTATTCTTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021138
TRAF2 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-1370s21c1
Sequence:CCGGATAACCGGGAGCACGTGATTGCTCGAGCAATCACGTGCTCCCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-691s21c1
Sequence:CCGGTGTCGAGTCCCTTGCAGATTCCTCGAGGAATCTGCAAGGGACTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-272s21c1
Sequence:CCGGGTGTTCACGAGGGCATATATGCTCGAGCATATATGCCCTCGTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-320s21c1
Sequence:CCGGGTTCGGCCTTCCCAGATAATGCTCGAGCATTATCTGGGAAGGCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-1362s1c1
Sequence:CCGGCGACCAGAATAACCGGGAGCACTCGAGTGCTCCCGGTTATTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-699s1c1
Sequence:CCGGCCCTTGCAGATTCCACGCCATCTCGAGATGGCGTGGAATCTGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021138.x-1955s1c1
Sequence:CCGGCTCGGGCATGACAGGCAGAAACTCGAGTTTCTGCCTGTCATGCCCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-729s1c1
Sequence:CCGGCGAGACGGTAGAGGGTGAGAACTCGAGTTCTCACCCTCTACCGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-407s1c1
Sequence:CCGGCCCTGAAAGAATACGAGAGCTCTCGAGAGCTCTCGTATTCTTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021138
TRAF2 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-1370s21c1
Sequence:CCGGATAACCGGGAGCACGTGATTGCTCGAGCAATCACGTGCTCCCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-691s21c1
Sequence:CCGGTGTCGAGTCCCTTGCAGATTCCTCGAGGAATCTGCAAGGGACTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-272s21c1
Sequence:CCGGGTGTTCACGAGGGCATATATGCTCGAGCATATATGCCCTCGTGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021138.3-320s21c1
Sequence:CCGGGTTCGGCCTTCCCAGATAATGCTCGAGCATTATCTGGGAAGGCCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-1362s1c1
Sequence:CCGGCGACCAGAATAACCGGGAGCACTCGAGTGCTCCCGGTTATTCTGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-699s1c1
Sequence:CCGGCCCTTGCAGATTCCACGCCATCTCGAGATGGCGTGGAATCTGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004572    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021138.x-1955s1c1
Sequence:CCGGCTCGGGCATGACAGGCAGAAACTCGAGTTTCTGCCTGTCATGCCCGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-729s1c1
Sequence:CCGGCGAGACGGTAGAGGGTGAGAACTCGAGTTCTCACCCTCTACCGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021138.x-407s1c1
Sequence:CCGGCCCTGAAAGAATACGAGAGCTCTCGAGAGCTCTCGTATTCTTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009422
VALIDATED
TRAF2 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-664s21c1
Sequence:CCGGGACGTTTCAGGACCATGTTAGCTCGAGCTAACATGGTCCTGAAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-1530s21c1
Sequence:GTACCGGCGATCTTCATCAAAGCTATTGCTCGAGCAATAGCTTTGATGAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009422.2-2175s21c1
Sequence:CCGGTCACTTCTGCCTTACTCATTCCTCGAGGAATGAGTAAGGCAGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-1340s21c1
Sequence:CCGGTTTAATCAGAAGGTAACATTGCTCGAGCAATGTTACCTTCTGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-464s21c1
Sequence:CCGGACGGAGTGTCCTGCATGTAAACTCGAGTTTACATGCAGGACACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009422.2-1642s21c1
Sequence:CCGGGTGGGCAGGCTTGGTGTAAATCTCGAGATTTACACCAAGCCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-325s21c1
Sequence:CCGGTAGTTCGGCCTTTCCAGATAACTCGAGTTATCTGGAAAGGCCGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-582s21c1
Sequence:CCGGTGGACCTGGAGGTACACTATGCTCGAGCATAGTGTACCTCCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009422.1-2313s1c1
Sequence:CCGGGCCTGGTTTGCACAATAGGAACTCGAGTTCCTATTGTGCAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009422.1-1005s1c1
Sequence:CCGGGCCCTGAGTAACAAGGTGCAACTCGAGTTGCACCTTGTTACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009422.1-409s1c1
Sequence:CCGGCCTTGAAAGAATACGAGAGCTCTCGAGAGCTCTCGTATTCTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009422.1-1524s1c1
Sequence:CCGGGCGATCTTCATCAAAGCTATTCTCGAGAATAGCTTTGATGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009422.1-1089s1c1
Sequence:CCGGGAGTTGGAAGTATCCACCTATCTCGAGATAGGTGGATACTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009422
VALIDATED
TRAF2 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-664s21c1
Sequence:CCGGGACGTTTCAGGACCATGTTAGCTCGAGCTAACATGGTCCTGAAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-1530s21c1
Sequence:GTACCGGCGATCTTCATCAAAGCTATTGCTCGAGCAATAGCTTTGATGAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009422.2-2175s21c1
Sequence:CCGGTCACTTCTGCCTTACTCATTCCTCGAGGAATGAGTAAGGCAGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-1340s21c1
Sequence:CCGGTTTAATCAGAAGGTAACATTGCTCGAGCAATGTTACCTTCTGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-464s21c1
Sequence:CCGGACGGAGTGTCCTGCATGTAAACTCGAGTTTACATGCAGGACACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009422.2-1642s21c1
Sequence:CCGGGTGGGCAGGCTTGGTGTAAATCTCGAGATTTACACCAAGCCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-325s21c1
Sequence:CCGGTAGTTCGGCCTTTCCAGATAACTCGAGTTATCTGGAAAGGCCGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-582s21c1
Sequence:CCGGTGGACCTGGAGGTACACTATGCTCGAGCATAGTGTACCTCCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009422.1-2313s1c1
Sequence:CCGGGCCTGGTTTGCACAATAGGAACTCGAGTTCCTATTGTGCAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009422.1-1005s1c1
Sequence:CCGGGCCCTGAGTAACAAGGTGCAACTCGAGTTGCACCTTGTTACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009422.1-409s1c1
Sequence:CCGGCCTTGAAAGAATACGAGAGCTCTCGAGAGCTCTCGTATTCTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009422.1-1524s1c1
Sequence:CCGGGCGATCTTCATCAAAGCTATTCTCGAGAATAGCTTTGATGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009422.1-1089s1c1
Sequence:CCGGGAGTTGGAAGTATCCACCTATCTCGAGATAGGTGGATACTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009422
VALIDATED
TRAF2 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-664s21c1
Sequence:CCGGGACGTTTCAGGACCATGTTAGCTCGAGCTAACATGGTCCTGAAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-1530s21c1
Sequence:GTACCGGCGATCTTCATCAAAGCTATTGCTCGAGCAATAGCTTTGATGAAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009422.2-2175s21c1
Sequence:CCGGTCACTTCTGCCTTACTCATTCCTCGAGGAATGAGTAAGGCAGAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-1340s21c1
Sequence:CCGGTTTAATCAGAAGGTAACATTGCTCGAGCAATGTTACCTTCTGATTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-464s21c1
Sequence:CCGGACGGAGTGTCCTGCATGTAAACTCGAGTTTACATGCAGGACACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009422.2-1642s21c1
Sequence:CCGGGTGGGCAGGCTTGGTGTAAATCTCGAGATTTACACCAAGCCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-325s21c1
Sequence:CCGGTAGTTCGGCCTTTCCAGATAACTCGAGTTATCTGGAAAGGCCGAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009422.2-582s21c1
Sequence:CCGGTGGACCTGGAGGTACACTATGCTCGAGCATAGTGTACCTCCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009422.1-2313s1c1
Sequence:CCGGGCCTGGTTTGCACAATAGGAACTCGAGTTCCTATTGTGCAAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009422.1-1005s1c1
Sequence:CCGGGCCCTGAGTAACAAGGTGCAACTCGAGTTGCACCTTGTTACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009422.1-409s1c1
Sequence:CCGGCCTTGAAAGAATACGAGAGCTCTCGAGAGCTCTCGTATTCTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009422.1-1524s1c1
Sequence:CCGGGCGATCTTCATCAAAGCTATTCTCGAGAATAGCTTTGATGAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009422.1-1089s1c1
Sequence:CCGGGAGTTGGAAGTATCCACCTATCTCGAGATAGGTGGATACTTCCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks