EMAIL THIS PAGE TO A FRIEND

TRAF3

TNF receptor-associated factor 3

Synonyms: CAP-1 CAP1 CD40bp CRAF1 IIAE5 LAP1
Gene ID:
Human(7187) Summary: The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
Mouse(22031) TNF receptor-associated factor 3
Rat(362788) Tnf receptor-associated factor 3
Zebrafish(445119) TNF receptor-associated factor 3
domestic cat(101096739) TNF receptor-associated factor 3
Horse(100055110) TNF receptor-associated factor 3
dog(490867) TNF receptor-associated factor 3
chicken(423471) TNF receptor-associated factor 3
naked mole-rat(101718736) TNF receptor-associated factor 3
domestic guinea pig(100734492) TNF receptor-associated factor 3
cow(506182) TNF receptor-associated factor 3
sheep(100036758) TNF receptor-associated factor 3
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003300 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092501 MISSION® esiRNA esiRNA human TRAF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003300 Rosetta Predictions human pricing
NM_145725 Rosetta Predictions human pricing
NM_145726 Rosetta Predictions human pricing
NM_001108724 Rosetta Predictions rat pricing
NM_001048206 Rosetta Predictions mouse pricing
NM_011632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335396 predicted 533
2 SASI_Hs02_00335397 predicted 604
3 SASI_Hs01_00114399 predicted 1328
4 SASI_Hs01_00114401 predicted 1719
5 SASI_Hs01_00114402 predicted 1444
6 SASI_Hs01_00114403 predicted 1962
7 SASI_Hs01_00114404 predicted 1257
8 SASI_Hs01_00114405 predicted 480
9 SASI_Hs01_00114406 predicted 1660
10 SASI_Hs01_00114407 predicted 1554
11 SASI_Hs01_00114400 predicted 1827
12 SASI_Hs01_00114408 predicted 1732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365319 predicted 674
2 SASI_Hs02_00365320 predicted 738
3 SASI_Hs01_00180941 predicted 1465
4 SASI_Hs01_00180943 predicted 1858
5 SASI_Hs01_00180944 predicted 1584
6 SASI_Hs01_00180945 predicted 2098
7 SASI_Hs01_00180946 predicted 1397
8 SASI_Hs01_00180947 predicted 616
9 SASI_Hs01_00180948 predicted 1803
10 SASI_Hs01_00180949 predicted 1691
11 SASI_Hs01_00180942 predicted 1957
12 SASI_Hs01_00180950 predicted 1872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00365321 predicted 674
2 SASI_Hs02_00365322 predicted 745
3 SASI_Hs01_00043640 predicted 1390
4 SASI_Hs01_00043642 predicted 1778
5 SASI_Hs01_00043643 predicted 1515
6 SASI_Hs01_00043644 predicted 2028
7 SASI_Hs01_00043645 predicted 1316
8 SASI_Hs01_00043646 predicted 620
9 SASI_Hs01_00043647 predicted 1720
10 SASI_Hs01_00043648 predicted 1618
11 SASI_Hs01_00043641 predicted 1889
12 SASI_Hs01_00043649 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241455 predicted 570
2 SASI_Rn02_00241456 predicted 1759
3 SASI_Rn02_00241457 predicted 1712
4 SASI_Rn02_00241458 predicted 1467
5 SASI_Rn02_00241459 predicted 1547
6 SASI_Rn02_00241460 predicted 1557
7 SASI_Rn02_00241461 predicted 844
8 SASI_Rn02_00241462 predicted 617
9 SASI_Rn02_00241463 predicted 1090
10 SASI_Rn02_00241464 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292199 predicted 1753
2 SASI_Mm02_00292200 predicted 450
3 SASI_Mm02_00292201 predicted 1582
4 SASI_Mm02_00292202 predicted 1426
5 SASI_Mm02_00292203 predicted 563
6 SASI_Mm02_00292204 predicted 496
7 SASI_Mm02_00292205 predicted 1742
8 SASI_Mm02_00292206 predicted 1724
9 SASI_Mm02_00292207 predicted 1814
10 SASI_Mm02_00292208 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321079 predicted 1828
2 SASI_Mm01_00049154 predicted 447
3 SASI_Mm02_00321080 predicted 1663
4 SASI_Mm01_00049152 predicted 1502
5 SASI_Mm01_00049158 predicted 570
6 SASI_Mm01_00049159 predicted 495
7 SASI_Mm01_00049160 predicted 1819
8 SASI_Mm01_00049161 predicted 1801
9 SASI_Mm02_00321081 predicted 1881
10 SASI_Mm02_00321082 predicted 1968
11 SASI_Mm01_00049153 predicted 1234
12 SASI_Mm01_00049155 predicted 754
13 SASI_Mm01_00049156 predicted 1249
14 SASI_Mm01_00049157 predicted 935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011632
TRAF3 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000453976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-473s21c1
Sequence:CCGGACAAGGTGTTTAAGGATAATTCTCGAGAATTATCCTTAAACACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1967s1c1
Sequence:CCGGGCCTTTCTACACAGGTTATTTCTCGAGAAATAACCTGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1191s1c1
Sequence:CCGGCCCATGATCAAACTGCAGAAACTCGAGTTTCTGCAGTTTGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-919s1c1
Sequence:CCGGGCATCATCAAAGACAAGGTATCTCGAGATACCTTGTCTTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1565s1c1
Sequence:CCGGCCGAAACAACGAGTCCAAGATCTCGAGATCTTGGACTCGTTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-2239s1c1
Sequence:CCGGGCCCAGTCTTTGTCGCCCAAACTCGAGTTTGGGCGACAAAGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-842s21c1
Sequence:CCGGACTTGTCCGAGTGTGTCAATGCTCGAGCATTGACACACTCGGACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011632.2-2344s21c1
Sequence:CCGGGCAATCTTGTTTCAAATATAGCTCGAGCTATATTTGAAACAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-441s21c1
Sequence:CCGGATGCACAGCGTGCCAAGAAAGCTCGAGCTTTCTTGGCACGCTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-1838s21c1
Sequence:CCGGCAATCTTTATTAAGGTCATAGCTCGAGCTATGACCTTAATAAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011632
TRAF3 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000453976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-473s21c1
Sequence:CCGGACAAGGTGTTTAAGGATAATTCTCGAGAATTATCCTTAAACACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1967s1c1
Sequence:CCGGGCCTTTCTACACAGGTTATTTCTCGAGAAATAACCTGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1191s1c1
Sequence:CCGGCCCATGATCAAACTGCAGAAACTCGAGTTTCTGCAGTTTGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-919s1c1
Sequence:CCGGGCATCATCAAAGACAAGGTATCTCGAGATACCTTGTCTTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1565s1c1
Sequence:CCGGCCGAAACAACGAGTCCAAGATCTCGAGATCTTGGACTCGTTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-2239s1c1
Sequence:CCGGGCCCAGTCTTTGTCGCCCAAACTCGAGTTTGGGCGACAAAGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-842s21c1
Sequence:CCGGACTTGTCCGAGTGTGTCAATGCTCGAGCATTGACACACTCGGACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011632.2-2344s21c1
Sequence:CCGGGCAATCTTGTTTCAAATATAGCTCGAGCTATATTTGAAACAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-441s21c1
Sequence:CCGGATGCACAGCGTGCCAAGAAAGCTCGAGCTTTCTTGGCACGCTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-1838s21c1
Sequence:CCGGCAATCTTTATTAAGGTCATAGCTCGAGCTATGACCTTAATAAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011632
TRAF3 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000453976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-473s21c1
Sequence:CCGGACAAGGTGTTTAAGGATAATTCTCGAGAATTATCCTTAAACACCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1967s1c1
Sequence:CCGGGCCTTTCTACACAGGTTATTTCTCGAGAAATAACCTGTGTAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1191s1c1
Sequence:CCGGCCCATGATCAAACTGCAGAAACTCGAGTTTCTGCAGTTTGATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-919s1c1
Sequence:CCGGGCATCATCAAAGACAAGGTATCTCGAGATACCTTGTCTTTGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-1565s1c1
Sequence:CCGGCCGAAACAACGAGTCCAAGATCTCGAGATCTTGGACTCGTTGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011632.1-2239s1c1
Sequence:CCGGGCCCAGTCTTTGTCGCCCAAACTCGAGTTTGGGCGACAAAGACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-842s21c1
Sequence:CCGGACTTGTCCGAGTGTGTCAATGCTCGAGCATTGACACACTCGGACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011632.2-2344s21c1
Sequence:CCGGGCAATCTTGTTTCAAATATAGCTCGAGCTATATTTGAAACAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-441s21c1
Sequence:CCGGATGCACAGCGTGCCAAGAAAGCTCGAGCTTTCTTGGCACGCTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011632.2-1838s21c1
Sequence:CCGGCAATCTTTATTAAGGTCATAGCTCGAGCTATGACCTTAATAAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003300
TRAF3 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1162s1c1
Sequence:CCGGCCTTCATTTACAGCGAGTGATCTCGAGATCACTCGCTGTAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1673s1c1
Sequence:CCGGCCTTGGCCGTTTAAGCAGAAACTCGAGTTTCTGCTTAAACGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-590s1c1
Sequence:CCGGGAGCAGTTAATGCTGGGACATCTCGAGATGTCCCAGCATTAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-483s1c1
Sequence:CCGGCGTGTCAAGAGAGCATCGTTACTCGAGTAACGATGCTCTCTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1540s1c1
Sequence:CCGGCCAGCCTTTCTACACTGGTTACTCGAGTAACCAGTGTAGAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-1666s21c1
Sequence:CCGGCCTGCTTCCTTGGCCGTTTAACTCGAGTTAAACGGCCAAGGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-707s21c1
Sequence:CCGGCACGTGGAGAAGGCGTGTAAACTCGAGTTTACACGCCTTCTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-1553s21c1
Sequence:CCGGACTGGTTACTTTGGCTATAAGCTCGAGCTTATAGCCAAAGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-498s21c1
Sequence:CCGGTCGTTAAAGATAAGGTGTTTACTCGAGTAAACACCTTATCTTTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003300
TRAF3 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1162s1c1
Sequence:CCGGCCTTCATTTACAGCGAGTGATCTCGAGATCACTCGCTGTAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1673s1c1
Sequence:CCGGCCTTGGCCGTTTAAGCAGAAACTCGAGTTTCTGCTTAAACGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-590s1c1
Sequence:CCGGGAGCAGTTAATGCTGGGACATCTCGAGATGTCCCAGCATTAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-483s1c1
Sequence:CCGGCGTGTCAAGAGAGCATCGTTACTCGAGTAACGATGCTCTCTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1540s1c1
Sequence:CCGGCCAGCCTTTCTACACTGGTTACTCGAGTAACCAGTGTAGAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-1666s21c1
Sequence:CCGGCCTGCTTCCTTGGCCGTTTAACTCGAGTTAAACGGCCAAGGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-707s21c1
Sequence:CCGGCACGTGGAGAAGGCGTGTAAACTCGAGTTTACACGCCTTCTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-1553s21c1
Sequence:CCGGACTGGTTACTTTGGCTATAAGCTCGAGCTTATAGCCAAAGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-498s21c1
Sequence:CCGGTCGTTAAAGATAAGGTGTTTACTCGAGTAAACACCTTATCTTTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003300
TRAF3 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1162s1c1
Sequence:CCGGCCTTCATTTACAGCGAGTGATCTCGAGATCACTCGCTGTAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1673s1c1
Sequence:CCGGCCTTGGCCGTTTAAGCAGAAACTCGAGTTTCTGCTTAAACGGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-590s1c1
Sequence:CCGGGAGCAGTTAATGCTGGGACATCTCGAGATGTCCCAGCATTAACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-483s1c1
Sequence:CCGGCGTGTCAAGAGAGCATCGTTACTCGAGTAACGATGCTCTCTTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003300.2-1540s1c1
Sequence:CCGGCCAGCCTTTCTACACTGGTTACTCGAGTAACCAGTGTAGAAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-1666s21c1
Sequence:CCGGCCTGCTTCCTTGGCCGTTTAACTCGAGTTAAACGGCCAAGGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-707s21c1
Sequence:CCGGCACGTGGAGAAGGCGTGTAAACTCGAGTTTACACGCCTTCTCCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-1553s21c1
Sequence:CCGGACTGGTTACTTTGGCTATAAGCTCGAGCTTATAGCCAAAGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003300.2-498s21c1
Sequence:CCGGTCGTTAAAGATAAGGTGTTTACTCGAGTAAACACCTTATCTTTAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks