EMAIL THIS PAGE TO A FRIEND

TRAF3IP1

TNF receptor-associated factor 3 interacting protein 1

Synonyms: MIP-T3 MIPT3
UniProtKB ID: Q8TDR0, Q6PCT1, Q7L8N9, Q9NRD6, Q9Y4Q1
Gene ID:
Mouse(74019) TRAF3 interacting protein 1
Rat(363286) TNF receptor-associated factor 3 interacting protein 1
cow(504984) TNF receptor-associated factor 3 interacting protein 1
sheep(101108537) TNF receptor-associated factor 3 interacting protein 1
domestic guinea pig(100728161) TNF receptor-associated factor 3 interacting protein 1
naked mole-rat(101724773) TNF receptor-associated factor 3 interacting protein 1
Zebrafish(393572) TNF receptor-associated factor 3 interacting protein 1
chicken(424029) NF receptor-associated factor 3 interacting protein 1
domestic cat(101088604) TNF receptor-associated factor 3 interacting protein 1
Horse(100066684) TNF receptor-associated factor 3 interacting protein 1
dog(607339) TNF receptor-associated factor 3 interacting protein 1
Gene Class: Cytoskeleton
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015650 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015650 Rosetta Predictions human pricing
NM_001012204 Rosetta Predictions rat pricing
XM_576611 Rosetta Predictions rat pricing
NM_028718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144087 predicted 1285
2 SASI_Hs01_00144088 predicted 1337
3 SASI_Hs01_00144089 predicted 1559
4 SASI_Hs01_00144091 predicted 1393
5 SASI_Hs01_00144092 predicted 1703
6 SASI_Hs02_00348255 predicted 1398
7 SASI_Hs01_00144093 predicted 1546
8 SASI_Hs01_00144094 predicted 1419
9 SASI_Hs02_00348256 predicted 1342
10 SASI_Hs01_00144096 predicted 349
11 SASI_Hs01_00144090 predicted 1354
12 SASI_Hs01_00144095 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072203 predicted 1553
2 SASI_Rn01_00072204 predicted 309
3 SASI_Rn01_00072206 predicted 311
4 SASI_Rn01_00072207 predicted 1137
5 SASI_Rn02_00200443 predicted 1103
6 SASI_Rn01_00072210 predicted 1328
7 SASI_Rn01_00072211 predicted 641
8 SASI_Rn01_00072212 predicted 1558
9 SASI_Rn02_00200444 predicted 1104
10 SASI_Rn02_00200445 predicted 1637
11 SASI_Rn01_00072205 predicted 299
12 SASI_Rn01_00072208 predicted 1298
13 SASI_Rn01_00072209 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166440 predicted 641
2 SASI_Rn01_00166441 predicted 1768
3 SASI_Rn01_00166442 predicted 1992
4 SASI_Rn01_00166443 predicted 563
5 SASI_Rn01_00166444 predicted 1964
6 SASI_Rn01_00166445 predicted 1999
7 SASI_Rn01_00166446 predicted 1833
8 SASI_Rn01_00166447 predicted 602
9 SASI_Rn01_00166448 predicted 555
10 SASI_Rn01_00166449 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151383 predicted 542
2 SASI_Mm01_00151384 predicted 1537
3 SASI_Mm01_00151385 predicted 1094
4 SASI_Mm01_00151386 predicted 983
5 SASI_Mm02_00334271 predicted 1373
6 SASI_Mm01_00151387 predicted 577
7 SASI_Mm01_00151388 predicted 1891
8 SASI_Mm01_00151389 predicted 1576
9 SASI_Mm01_00151390 predicted 531
10 SASI_Mm01_00151391 predicted 571
11 SASI_Mm01_00151382 predicted 1545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015650
TRAF3IP1 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 3 interacting protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015650.3-1332s21c1
Sequence:CCGGAGTCTGCGGTGTGAGAATATTCTCGAGAATATTCTCACACCGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015650.3-2343s21c1
Sequence:CCGGTGTAAGCATGTTAAGTGTATTCTCGAGAATACACTTAACATGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015650.3-617s21c1
Sequence:CCGGGGATAGAGGAGACGCTGAAATCTCGAGATTTCAGCGTCTCCTCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-1707s1c1
Sequence:CCGGGAGTCACACAATTCTGACAATCTCGAGATTGTCAGAATTGTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-2269s1c1
Sequence:CCGGGTATCAATTTGACTTCGAGAACTCGAGTTCTCGAAGTCAAATTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-384s1c1
Sequence:CCGGGCCGAGATGAAGTCTGATAATCTCGAGATTATCAGACTTCATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-559s1c1
Sequence:CCGGGCTGTCTCAACAAGCTCTCTACTCGAGTAGAGAGCTTGTTGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-1110s1c1
Sequence:CCGGGAGCATGACAAACCTGAGAAACTCGAGTTTCTCAGGTTTGTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015650
TRAF3IP1 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 3 interacting protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015650.3-1332s21c1
Sequence:CCGGAGTCTGCGGTGTGAGAATATTCTCGAGAATATTCTCACACCGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015650.3-2343s21c1
Sequence:CCGGTGTAAGCATGTTAAGTGTATTCTCGAGAATACACTTAACATGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015650.3-617s21c1
Sequence:CCGGGGATAGAGGAGACGCTGAAATCTCGAGATTTCAGCGTCTCCTCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-1707s1c1
Sequence:CCGGGAGTCACACAATTCTGACAATCTCGAGATTGTCAGAATTGTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-2269s1c1
Sequence:CCGGGTATCAATTTGACTTCGAGAACTCGAGTTCTCGAAGTCAAATTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-384s1c1
Sequence:CCGGGCCGAGATGAAGTCTGATAATCTCGAGATTATCAGACTTCATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-559s1c1
Sequence:CCGGGCTGTCTCAACAAGCTCTCTACTCGAGTAGAGAGCTTGTTGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-1110s1c1
Sequence:CCGGGAGCATGACAAACCTGAGAAACTCGAGTTTCTCAGGTTTGTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015650
TRAF3IP1 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 3 interacting protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015650.3-1332s21c1
Sequence:CCGGAGTCTGCGGTGTGAGAATATTCTCGAGAATATTCTCACACCGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418483    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015650.3-2343s21c1
Sequence:CCGGTGTAAGCATGTTAAGTGTATTCTCGAGAATACACTTAACATGCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015650.3-617s21c1
Sequence:CCGGGGATAGAGGAGACGCTGAAATCTCGAGATTTCAGCGTCTCCTCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-1707s1c1
Sequence:CCGGGAGTCACACAATTCTGACAATCTCGAGATTGTCAGAATTGTGTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-2269s1c1
Sequence:CCGGGTATCAATTTGACTTCGAGAACTCGAGTTCTCGAAGTCAAATTGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-384s1c1
Sequence:CCGGGCCGAGATGAAGTCTGATAATCTCGAGATTATCAGACTTCATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-559s1c1
Sequence:CCGGGCTGTCTCAACAAGCTCTCTACTCGAGTAGAGAGCTTGTTGAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015650.2-1110s1c1
Sequence:CCGGGAGCATGACAAACCTGAGAAACTCGAGTTTCTCAGGTTTGTCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028718
VALIDATED
TRAF3IP1 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 3 interacting protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-941s21c1
Sequence:CCGGATCGAAGAATGGAGAACATACCTCGAGGTATGTTCTCCATTCTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-415s21c1
Sequence:CCGGATGAGCTGCTTCAATTGATTGCTCGAGCAATCAATTGAAGCAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-580s21c1
Sequence:CCGGGAATACACAAAGAGGATAAACCTCGAGGTTTATCCTCTTTGTGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-1105s21c1
Sequence:CCGGCATCTAGGTCCTCGACGTTAACTCGAGTTAACGTCGAGGACCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028718.1-2187s21c1
Sequence:CCGGCCTTTGTGGGAGGGCTTATTTCTCGAGAAATAAGCCCTCCCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028718.1-405s1c1
Sequence:CCGGGAAAGAACCAATGAGCTGCTTCTCGAGAAGCAGCTCATTGGTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028718.1-419s1c1
Sequence:CCGGGCTGCTTCAATTGATTGGCAACTCGAGTTGCCAATCAATTGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028718
VALIDATED
TRAF3IP1 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 3 interacting protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-941s21c1
Sequence:CCGGATCGAAGAATGGAGAACATACCTCGAGGTATGTTCTCCATTCTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-415s21c1
Sequence:CCGGATGAGCTGCTTCAATTGATTGCTCGAGCAATCAATTGAAGCAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-580s21c1
Sequence:CCGGGAATACACAAAGAGGATAAACCTCGAGGTTTATCCTCTTTGTGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-1105s21c1
Sequence:CCGGCATCTAGGTCCTCGACGTTAACTCGAGTTAACGTCGAGGACCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028718.1-2187s21c1
Sequence:CCGGCCTTTGTGGGAGGGCTTATTTCTCGAGAAATAAGCCCTCCCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028718.1-405s1c1
Sequence:CCGGGAAAGAACCAATGAGCTGCTTCTCGAGAAGCAGCTCATTGGTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028718.1-419s1c1
Sequence:CCGGGCTGCTTCAATTGATTGGCAACTCGAGTTGCCAATCAATTGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028718
VALIDATED
TRAF3IP1 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 3 interacting protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-941s21c1
Sequence:CCGGATCGAAGAATGGAGAACATACCTCGAGGTATGTTCTCCATTCTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-415s21c1
Sequence:CCGGATGAGCTGCTTCAATTGATTGCTCGAGCAATCAATTGAAGCAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-580s21c1
Sequence:CCGGGAATACACAAAGAGGATAAACCTCGAGGTTTATCCTCTTTGTGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028718.1-1105s21c1
Sequence:CCGGCATCTAGGTCCTCGACGTTAACTCGAGTTAACGTCGAGGACCTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028718.1-2187s21c1
Sequence:CCGGCCTTTGTGGGAGGGCTTATTTCTCGAGAAATAAGCCCTCCCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028718.1-405s1c1
Sequence:CCGGGAAAGAACCAATGAGCTGCTTCTCGAGAAGCAGCTCATTGGTTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028718.1-419s1c1
Sequence:CCGGGCTGCTTCAATTGATTGGCAACTCGAGTTGCCAATCAATTGAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks