EMAIL THIS PAGE TO A FRIEND

TRAF3IP2

TRAF3 interacting protein 2

Synonyms: ACT1 C6orf2 C6orf4 C6orf5 C6orf6 CIKS PSORS13
Gene ID:
Human(10758) Summary: This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
Mouse(103213) TRAF3 interacting protein 2
Rat(361857) Traf3 interacting protein 2
Zebrafish(386940) TRAF3 interacting protein 2
chicken(421752) TRAF3 interacting protein 2
Horse(100066812) TRAF3 interacting protein 2
domestic cat(101085125) TRAF3 interacting protein 2
dog(475031) TRAF3 interacting protein 2
naked mole-rat(101721876) TRAF3 interacting protein 2
Domestic Rabbit(100338995) TRAF3 interacting protein 2
domestic guinea pig(100728787) TRAF3 interacting protein 2
cow(616801) TRAF3 interacting protein 2
sheep(101109809) TRAF3 interacting protein 2
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147200 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147200 Rosetta Predictions human pricing
NM_147686 Rosetta Predictions human pricing
NM_001044248 Rosetta Predictions rat pricing
NM_134000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218711 predicted 672
2 SASI_Hs01_00218712 predicted 1431
3 SASI_Hs01_00218713 predicted 417
4 SASI_Hs01_00218714 predicted 1556
5 SASI_Hs01_00218715 predicted 1224
6 SASI_Hs01_00218716 predicted 1564
7 SASI_Hs01_00218717 predicted 1488
8 SASI_Hs01_00218718 predicted 914
9 SASI_Hs01_00218719 predicted 680
10 SASI_Hs01_00218720 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067884 predicted 818
2 SASI_Hs01_00067885 predicted 1581
3 SASI_Hs01_00067886 predicted 570
4 SASI_Hs01_00067887 predicted 1701
5 SASI_Hs01_00067888 predicted 1377
6 SASI_Hs01_00067889 predicted 1716
7 SASI_Hs01_00067890 predicted 1634
8 SASI_Hs01_00067891 predicted 1056
9 SASI_Hs01_00067892 predicted 824
10 SASI_Hs01_00067893 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205207 predicted 442
2 SASI_Rn02_00205208 predicted 1257
3 SASI_Rn02_00205209 predicted 538
4 SASI_Rn02_00205210 predicted 1270
5 SASI_Rn02_00205211 predicted 425
6 SASI_Rn02_00205212 predicted 1546
7 SASI_Rn02_00205213 predicted 641
8 SASI_Rn02_00205214 predicted 1437
9 SASI_Rn02_00205215 predicted 1424
10 SASI_Rn02_00205216 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027963 predicted 1884
2 SASI_Mm01_00027964 predicted 850
3 SASI_Mm01_00027965 predicted 842
4 SASI_Mm02_00339143 predicted 1731
5 SASI_Mm01_00027966 predicted 1166
6 SASI_Mm01_00027967 predicted 1672
7 SASI_Mm01_00027968 predicted 947
8 SASI_Mm01_00027969 predicted 1749
9 SASI_Mm01_00027970 predicted 852
10 SASI_Mm01_00027971 predicted 966
11 SASI_Mm01_00027972 predicted 1846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147200
VALIDATED
TRAF3IP2 MISSION shRNA Bacterial Glycerol Stock
TRAF3 interacting protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147200.1-1553s1c1
Sequence:CCGGCCTTAGGGATAAGACCGTGATCTCGAGATCACGGTCTTATCCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-1567s1c1
Sequence:CCGGCCGTGATGATAATCGTAGCAACTCGAGTTGCTACGATTATCATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147200.1-260s1c1
Sequence:CCGGGCTGAAACCAATCCCAGAATACTCGAGTATTCTGGGATTGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147200.1-1403s1c1
Sequence:CCGGGCGGAAAGTCTTTATCACTTACTCGAGTAAGTGATAAAGACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-982s1c1
Sequence:CCGGCATGGAACTATCATTACCATTCTCGAGAATGGTAATGATAGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147200.1-1518s1c1
Sequence:CCGGCGAGGCATTGATATCATTAAACTCGAGTTTAATGATATCAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-1772s1c1
Sequence:CCGGGCTTCAGAACACTCATGTCTACTCGAGTAGACATGAGTGTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147200
VALIDATED
TRAF3IP2 MISSION shRNA shRNA Plasmid DNA
TRAF3 interacting protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147200.1-1553s1c1
Sequence:CCGGCCTTAGGGATAAGACCGTGATCTCGAGATCACGGTCTTATCCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-1567s1c1
Sequence:CCGGCCGTGATGATAATCGTAGCAACTCGAGTTGCTACGATTATCATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147200.1-260s1c1
Sequence:CCGGGCTGAAACCAATCCCAGAATACTCGAGTATTCTGGGATTGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147200.1-1403s1c1
Sequence:CCGGGCGGAAAGTCTTTATCACTTACTCGAGTAAGTGATAAAGACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-982s1c1
Sequence:CCGGCATGGAACTATCATTACCATTCTCGAGAATGGTAATGATAGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147200.1-1518s1c1
Sequence:CCGGCGAGGCATTGATATCATTAAACTCGAGTTTAATGATATCAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-1772s1c1
Sequence:CCGGGCTTCAGAACACTCATGTCTACTCGAGTAGACATGAGTGTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147200
VALIDATED
TRAF3IP2 MISSION shRNA Lentiviral Transduction Particles
TRAF3 interacting protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147200.1-1553s1c1
Sequence:CCGGCCTTAGGGATAAGACCGTGATCTCGAGATCACGGTCTTATCCCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-1567s1c1
Sequence:CCGGCCGTGATGATAATCGTAGCAACTCGAGTTGCTACGATTATCATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147200.1-260s1c1
Sequence:CCGGGCTGAAACCAATCCCAGAATACTCGAGTATTCTGGGATTGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147200.1-1403s1c1
Sequence:CCGGGCGGAAAGTCTTTATCACTTACTCGAGTAAGTGATAAAGACTTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-982s1c1
Sequence:CCGGCATGGAACTATCATTACCATTCTCGAGAATGGTAATGATAGTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_147200.1-1518s1c1
Sequence:CCGGCGAGGCATTGATATCATTAAACTCGAGTTTAATGATATCAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_147200.1-1772s1c1
Sequence:CCGGGCTTCAGAACACTCATGTCTACTCGAGTAGACATGAGTGTTCTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134000
VALIDATED
TRAF3IP2 MISSION shRNA Bacterial Glycerol Stock
TRAF3 interacting protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-2341s1c1
Sequence:CCGGCCAGTCTAAATCATGCTCAAACTCGAGTTTGAGCATGATTTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134000.2-1430s1c1
Sequence:CCGGCCACCATCTAATGGAGTGGAACTCGAGTTCCACTCCATTAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-1960s1c1
Sequence:CCGGGCTTCAGAACACTCATGTTTACTCGAGTAAACATGAGTGTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134000.2-679s1c1
Sequence:CCGGCCCTGAACTTGGCAAAGATATCTCGAGATATCTTTGCCAAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-680s1c1
Sequence:CCGGCCTGAACTTGGCAAAGATATTCTCGAGAATATCTTTGCCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1960s21c1
Sequence:CCGGGCTTCAGAACACTCATGTTTACTCGAGTAAACATGAGTGTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-457s21c1
Sequence:CCGGAGAACCATTCCCGAGTCAATTCTCGAGAATTGACTCGGGAATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1732s21c1
Sequence:CCGGGGAGCGCTATCTTCGAGATAACTCGAGTTATCTCGAAGATAGCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1673s21c1
Sequence:CCGGCAAACTGCGATTGACATATTTCTCGAGAAATATGTCAATCGCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134000.3-2399s21c1
Sequence:CCGGTCAGTGGAGGTGGGCATATTACTCGAGTAATATGCCCACCTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134000
VALIDATED
TRAF3IP2 MISSION shRNA shRNA Plasmid DNA
TRAF3 interacting protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-2341s1c1
Sequence:CCGGCCAGTCTAAATCATGCTCAAACTCGAGTTTGAGCATGATTTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134000.2-1430s1c1
Sequence:CCGGCCACCATCTAATGGAGTGGAACTCGAGTTCCACTCCATTAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-1960s1c1
Sequence:CCGGGCTTCAGAACACTCATGTTTACTCGAGTAAACATGAGTGTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134000.2-679s1c1
Sequence:CCGGCCCTGAACTTGGCAAAGATATCTCGAGATATCTTTGCCAAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-680s1c1
Sequence:CCGGCCTGAACTTGGCAAAGATATTCTCGAGAATATCTTTGCCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1960s21c1
Sequence:CCGGGCTTCAGAACACTCATGTTTACTCGAGTAAACATGAGTGTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-457s21c1
Sequence:CCGGAGAACCATTCCCGAGTCAATTCTCGAGAATTGACTCGGGAATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1732s21c1
Sequence:CCGGGGAGCGCTATCTTCGAGATAACTCGAGTTATCTCGAAGATAGCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1673s21c1
Sequence:CCGGCAAACTGCGATTGACATATTTCTCGAGAAATATGTCAATCGCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134000.3-2399s21c1
Sequence:CCGGTCAGTGGAGGTGGGCATATTACTCGAGTAATATGCCCACCTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134000
VALIDATED
TRAF3IP2 MISSION shRNA Lentiviral Transduction Particles
TRAF3 interacting protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-2341s1c1
Sequence:CCGGCCAGTCTAAATCATGCTCAAACTCGAGTTTGAGCATGATTTAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134000.2-1430s1c1
Sequence:CCGGCCACCATCTAATGGAGTGGAACTCGAGTTCCACTCCATTAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-1960s1c1
Sequence:CCGGGCTTCAGAACACTCATGTTTACTCGAGTAAACATGAGTGTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134000.2-679s1c1
Sequence:CCGGCCCTGAACTTGGCAAAGATATCTCGAGATATCTTTGCCAAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134000.2-680s1c1
Sequence:CCGGCCTGAACTTGGCAAAGATATTCTCGAGAATATCTTTGCCAAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1960s21c1
Sequence:CCGGGCTTCAGAACACTCATGTTTACTCGAGTAAACATGAGTGTTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-457s21c1
Sequence:CCGGAGAACCATTCCCGAGTCAATTCTCGAGAATTGACTCGGGAATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1732s21c1
Sequence:CCGGGGAGCGCTATCTTCGAGATAACTCGAGTTATCTCGAAGATAGCGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134000.3-1673s21c1
Sequence:CCGGCAAACTGCGATTGACATATTTCTCGAGAAATATGTCAATCGCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134000.3-2399s21c1
Sequence:CCGGTCAGTGGAGGTGGGCATATTACTCGAGTAATATGCCCACCTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks