EMAIL THIS PAGE TO A FRIEND

TRAF3IP3

TRAF3 interacting protein 3

Synonyms: DJ434O14.3 T3JAM
UniProtKB ID: Q9Y228, A1L464, A6NIU9, Q2YDB5, Q4VY06, Q7Z706
Gene ID:
Human(80342) Summary: The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multiprotein assembly containing the phosphatase 2A catalytic subunit. [provided by RefSeq, May 2010]
Mouse(215243) TRAF3 interacting protein 3
Rat(360900) TRAF3 interacting protein 3
chicken(419862) TRAF3 interacting protein 3
dog(480014) TRAF3 interacting protein 3
Horse(100051575) TRAF3 interacting protein 3
domestic cat(101087895) TRAF3 interacting protein 3
cow(505371) TRAF3 interacting protein 3
sheep(101121532) TRAF3 interacting protein 3
domestic guinea pig(100727973) TRAF3 interacting protein 3
Domestic Rabbit(100342145) TRAF3 interacting protein 3
naked mole-rat(101717726) TRAF3 interacting protein 3
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025228 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025228 Rosetta Predictions human pricing
NM_001014132 Rosetta Predictions rat pricing
NM_153137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040189 predicted 769
2 SASI_Hs01_00040191 predicted 705
3 SASI_Hs01_00040192 predicted 1282
4 SASI_Hs01_00040193 predicted 892
5 SASI_Hs01_00040194 predicted 1498
6 SASI_Hs01_00040195 predicted 1492
7 SASI_Hs01_00040196 predicted 829
8 SASI_Hs01_00040197 predicted 1058
9 SASI_Hs02_00358030 predicted 757
10 SASI_Hs01_00040198 predicted 1285
11 SASI_Hs01_00040190 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068287 predicted 1511
2 SASI_Rn01_00068289 predicted 819
3 SASI_Rn01_00068290 predicted 855
4 SASI_Rn01_00068291 predicted 1357
5 SASI_Rn01_00068292 predicted 701
6 SASI_Rn01_00068293 predicted 1050
7 SASI_Rn01_00068294 predicted 628
8 SASI_Rn01_00068295 predicted 437
9 SASI_Rn01_00068296 predicted 825
10 SASI_Rn02_00201586 predicted 809
11 SASI_Rn01_00068288 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080069 predicted 1615
2 SASI_Mm01_00080072 predicted 1112
3 SASI_Mm01_00080073 predicted 1190
4 SASI_Mm01_00080074 predicted 508
5 SASI_Mm01_00080075 predicted 592
6 SASI_Mm01_00080077 predicted 629
7 SASI_Mm02_00343006 predicted 807
8 SASI_Mm01_00080078 predicted 942
9 SASI_Mm02_00343007 predicted 1313
10 SASI_Mm02_00343008 predicted 813
11 SASI_Mm01_00080070 predicted 958
12 SASI_Mm01_00080071 predicted 1775
13 SASI_Mm01_00080076 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153137
TRAF3IP3 MISSION shRNA Bacterial Glycerol Stock
TRAF3 interacting protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-1598s21c1
Sequence:CCGGGGACCTACAAGATCAACTAAACTCGAGTTTAGTTGATCTTGTAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-998s21c1
Sequence:CCGGCATCATTCAACTCTCGGAATACTCGAGTATTCCGAGAGTTGAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-1704s21c1
Sequence:CCGGGAACAGGAGAAGCTCTTAAAGCTCGAGCTTTAAGAGCTTCTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153137.2-1906s1c1
Sequence:CCGGCTGGCATCTATCTGAAGTAAACTCGAGTTTACTTCAGATAGATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-703s1c1
Sequence:CCGGCAGGGATAAGCTCTGAGGTTTCTCGAGAAACCTCAGAGCTTATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-691s1c1
Sequence:CCGGGACAGCAGGAAACAGGGATAACTCGAGTTATCCCTGTTTCCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-1692s1c1
Sequence:CCGGCCAAAGCTCTCCCTTGATGAACTCGAGTTCATCAAGGGAGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-870s1c1
Sequence:CCGGGCATTGCCAACAATAAAGAATCTCGAGATTCTTTATTGTTGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153137
TRAF3IP3 MISSION shRNA shRNA Plasmid DNA
TRAF3 interacting protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-1598s21c1
Sequence:CCGGGGACCTACAAGATCAACTAAACTCGAGTTTAGTTGATCTTGTAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-998s21c1
Sequence:CCGGCATCATTCAACTCTCGGAATACTCGAGTATTCCGAGAGTTGAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-1704s21c1
Sequence:CCGGGAACAGGAGAAGCTCTTAAAGCTCGAGCTTTAAGAGCTTCTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153137.2-1906s1c1
Sequence:CCGGCTGGCATCTATCTGAAGTAAACTCGAGTTTACTTCAGATAGATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-703s1c1
Sequence:CCGGCAGGGATAAGCTCTGAGGTTTCTCGAGAAACCTCAGAGCTTATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-691s1c1
Sequence:CCGGGACAGCAGGAAACAGGGATAACTCGAGTTATCCCTGTTTCCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-1692s1c1
Sequence:CCGGCCAAAGCTCTCCCTTGATGAACTCGAGTTCATCAAGGGAGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-870s1c1
Sequence:CCGGGCATTGCCAACAATAAAGAATCTCGAGATTCTTTATTGTTGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153137
TRAF3IP3 MISSION shRNA Lentiviral Transduction Particles
TRAF3 interacting protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-1598s21c1
Sequence:CCGGGGACCTACAAGATCAACTAAACTCGAGTTTAGTTGATCTTGTAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-998s21c1
Sequence:CCGGCATCATTCAACTCTCGGAATACTCGAGTATTCCGAGAGTTGAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153137.4-1704s21c1
Sequence:CCGGGAACAGGAGAAGCTCTTAAAGCTCGAGCTTTAAGAGCTTCTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153137.2-1906s1c1
Sequence:CCGGCTGGCATCTATCTGAAGTAAACTCGAGTTTACTTCAGATAGATGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-703s1c1
Sequence:CCGGCAGGGATAAGCTCTGAGGTTTCTCGAGAAACCTCAGAGCTTATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-691s1c1
Sequence:CCGGGACAGCAGGAAACAGGGATAACTCGAGTTATCCCTGTTTCCTGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-1692s1c1
Sequence:CCGGCCAAAGCTCTCCCTTGATGAACTCGAGTTCATCAAGGGAGAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153137.2-870s1c1
Sequence:CCGGGCATTGCCAACAATAAAGAATCTCGAGATTCTTTATTGTTGGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025228
VALIDATED
TRAF3IP3 MISSION shRNA Bacterial Glycerol Stock
TRAF3 interacting protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1409s21c1
Sequence:GTACCGGGGACCTACAAGATCAACTAAACTCGAGTTTAGTTGATCTTGTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1705s21c1
Sequence:CCGGACAACCTCAGTGACGAGTATCCTCGAGGATACTCGTCACTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1308s21c1
Sequence:CCGGATGAACCAGGCCCTGCGATTTCTCGAGAAATCGCAGGGCCTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-365s21c1
Sequence:CCGGCAGGCAAGAGATCCGTGAAAGCTCGAGCTTTCACGGATCTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025228.1-1887s21c1
Sequence:CCGGATAATTTGTGACAACTGCCTTCTCGAGAAGGCAGTTGTCACAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1356s1c1
Sequence:CCGGGCCAAGATTGAATGCCTGCAACTCGAGTTGCAGGCATTCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1566s1c1
Sequence:CCGGCCAAAGTCCTTCCCTAACGAACTCGAGTTCGTTAGGGAAGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-394s1c1
Sequence:CCGGGCCGTCCCAATGTGACCACTTCTCGAGAAGTGGTCACATTGGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1506s1c1
Sequence:CCGGCAGCTTCAAGAACAGGAGAAACTCGAGTTTCTCCTGTTCTTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_025228.1-986s1c1
Sequence:CCGGGCTATACACCTGTACCCAGAACTCGAGTTCTGGGTACAGGTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025228
VALIDATED
TRAF3IP3 MISSION shRNA shRNA Plasmid DNA
TRAF3 interacting protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1409s21c1
Sequence:GTACCGGGGACCTACAAGATCAACTAAACTCGAGTTTAGTTGATCTTGTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1705s21c1
Sequence:CCGGACAACCTCAGTGACGAGTATCCTCGAGGATACTCGTCACTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1308s21c1
Sequence:CCGGATGAACCAGGCCCTGCGATTTCTCGAGAAATCGCAGGGCCTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-365s21c1
Sequence:CCGGCAGGCAAGAGATCCGTGAAAGCTCGAGCTTTCACGGATCTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025228.1-1887s21c1
Sequence:CCGGATAATTTGTGACAACTGCCTTCTCGAGAAGGCAGTTGTCACAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1356s1c1
Sequence:CCGGGCCAAGATTGAATGCCTGCAACTCGAGTTGCAGGCATTCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1566s1c1
Sequence:CCGGCCAAAGTCCTTCCCTAACGAACTCGAGTTCGTTAGGGAAGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-394s1c1
Sequence:CCGGGCCGTCCCAATGTGACCACTTCTCGAGAAGTGGTCACATTGGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1506s1c1
Sequence:CCGGCAGCTTCAAGAACAGGAGAAACTCGAGTTTCTCCTGTTCTTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_025228.1-986s1c1
Sequence:CCGGGCTATACACCTGTACCCAGAACTCGAGTTCTGGGTACAGGTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025228
VALIDATED
TRAF3IP3 MISSION shRNA Lentiviral Transduction Particles
TRAF3 interacting protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1409s21c1
Sequence:GTACCGGGGACCTACAAGATCAACTAAACTCGAGTTTAGTTGATCTTGTAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1705s21c1
Sequence:CCGGACAACCTCAGTGACGAGTATCCTCGAGGATACTCGTCACTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-1308s21c1
Sequence:CCGGATGAACCAGGCCCTGCGATTTCTCGAGAAATCGCAGGGCCTGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025228.1-365s21c1
Sequence:CCGGCAGGCAAGAGATCCGTGAAAGCTCGAGCTTTCACGGATCTCTTGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025228.1-1887s21c1
Sequence:CCGGATAATTTGTGACAACTGCCTTCTCGAGAAGGCAGTTGTCACAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1356s1c1
Sequence:CCGGGCCAAGATTGAATGCCTGCAACTCGAGTTGCAGGCATTCAATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1566s1c1
Sequence:CCGGCCAAAGTCCTTCCCTAACGAACTCGAGTTCGTTAGGGAAGGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-394s1c1
Sequence:CCGGGCCGTCCCAATGTGACCACTTCTCGAGAAGTGGTCACATTGGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025228.1-1506s1c1
Sequence:CCGGCAGCTTCAAGAACAGGAGAAACTCGAGTTTCTCCTGTTCTTGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_025228.1-986s1c1
Sequence:CCGGGCTATACACCTGTACCCAGAACTCGAGTTCTGGGTACAGGTGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks